No Evidence of Human Polyomavirus 9, WU and KI DNA in Kidney and Urinary Bladder Tumour Tissue Samples

As all known human pathogenic viruses of the Polyomaviridae family encode early regulatory tumour antigens, the potential oncogenic role of these viruses has been suggested [1,2,3,4] since the discovery of the first human polyomavirus (HPyV), BK polyomavirus (BKPyV) [5]. This suggestion was strengthened by in vitro and animal experiments with BKPyV that proved its transforming ability as reviewed previously [1,3,6]. After the primary infection, BKPyV establishes a lifelong persistent infection in the urinary tract and renal cells [2], hence there exist large number of studies of urinary tract neoplasia and cancers [7,8,9,10,11,12,13,14,15]. DNA, RNA or even proteins of the BK virus have been detected in different human tumours (brain, neuroblastoma, osteosarcoma, bladder, kidney, adrenal, prostate, genital, colon), but the role of BKPyV in human cancers is still controversial [1,4,6,16,17,18,19].

Although 11 new human pathogenic polyomaviruses (KI, WU, Merkel cell polyomavirus, HPyV6, HPyV7, trichodysplasia spinulosa-associated polyomavirus, HPyV9, HPyV10, STLPyV, HPyV12 and New Jersey polyomavirus) have been discovered since 2007 [20,21,22,23,24,25,26,27,28,29,30,31,32], so far only Merkel cell polyomavirus has been associated with a rare, cutaneous tumour. This was named Merkel cell carcinoma as an aetiological agent [33].

KI and WU polyomaviruses (KIPyV, WUPyV) were first described in 2007 from respiratory samples [20,21]. Subsequent seroepidemiological studies revealed that both viruses are widespread, the primary infections of which may occur during the early years of life, and adulthood seropositivities are 55-100% [34,35,36]. Most of the important questions about the pathogenesis of KIPyV and WUPyV have not been clarified. Their respiratory transmission is suggested based on prevalence data from numerous studies, as has been summarized in review articles [19,37,38]. Both KI and WU viruses were detected in urine samples, which suggests that these viruses may also infect the urinary tract [39,40,41].

HPyV9 was first detected in plasma and urine samples from renal transplant patients [25], following which two teams also found the viral DNA in urine samples [42,43]. The pathogenesis and the transmission of HPyV9 are not known, but it seems to be a frequent infectious agent since seropositivity in adults reaches 47% and increases with age [44].

Some publications about the prevalence of KIPyV, WUPyV and HPyV9 in different tumours are available, but these viruses have not been hitherto examined in bladder and renal cancers [45,46,47,48,49,50,51,52,53,54,55,56,57]. In the present study the prevalence of KIPyV, WUPyV, HPyV9 and BKPyV were examined by PCR in tissue samples from the urinary tract. In order to reveal a possible association of these viruses with urinary tract tumours, samples from renal and bladder neoplasia were examined.

The Regional and Institutional Ethics Committee of the University of Debrecen approved the study (IX-R-052/00016-29/2012). One hundred and ninety formalin-fixed paraffin-embedded tissue samples were analysed. The samples were submitted for routine diagnosis to the Department of Pathology, University of Debrecen, between 2010 and 2014. Data relating to the number of kidney biopsies (from renal transplant patients), and benign and malignant renal and urinary bladder tumour samples of 180 patients are summarized in table 1. Ten-micrometre-thick tissue sections were deparaffinised with xylene, then nucleic acid was isolated using the High Pure FFPETDNA Isolation Kit (Roche, Basel, Switzerland) according to the manufacturer's instructions. The quality and quantity of DNA eluted in 50 µl was checked with a NanoDrop 2000c Spectrophotometer (Thermo Scientific, Waltham, Mass., USA) and stored at -20°C until use.

To confirm the effectiveness of nucleic acid extraction, the presence of amplifiable DNA, β-globin PCR was used with the primers PCO3 (5′ACACAACTGTGTTCACTAGC3′) and PCO4 (5′CAACTTCATCCACGTTCACC3′). Five microliters of DNA were amplified in a final volume of 25 µl containing AmpliTaq Gold 360 Master Mix (Applied Biosystems, Foster City, Calif., USA) and 10 pmol of primers. The annealing temperature was 55°C. The sequences of the primers and probes along with the data and sensitivities of the PCRs are detailed in table 2.

To detect WU and KI virus DNA, nested and duplex real-time PCRs were carried out with the primers [58,59] and protocols detailed previously [39,40]. Plasmids containing the KIPyV and WUPyV genomes were used as positive controls kindly provided by Tobias Allander from Karolinska Institute (Stockholm, Sweden) and David Wang from Washington University (St. Louis, Miss., USA) [21,60]. HPyV9 was detected with a nested PCR as detailed previously [42] using primers described by Scuda et al. [25]. Plasmid containing HPyV9 genome kindly provided by Bernhard Ehlers from the Robert Koch Institute (Berlin, Germany) was used as a positive control. Nested PCRs were carried out with 5 µl of template DNA in a GeneAmp 9700 PCR system using AmpliTaq Gold 360 Master Mix (Applied Biosystems). The PCR products were visualized by electrophoresis in 1.5% agarose gel containing ethidium bromide. Real-time PCR with 10 µl of template DNA, TaqMan Universal PCR Master Mix and TaqMan probes was performed in an Applied Biosystems 7500 real-time PCR instrument and analysed by 7500 Software v2.0.6 (Applied Biosystems).

BK virus DNA was checked by real-time PCR according to the protocol detailed previously [61]. A nested PCR was also carried out with previously published primers [62]. Plasmid containing the complete genome of BKPyV Dunlop strain (kindly provided by Serena Delbue from the University of Milan, Italy) was used as a positive control. The first round of BKPyV nested PCR was performed in a final volume of 20 µl containing 5 µl of template DNA, 0.4 U of Phusion Green hot start high-fidelity polymerase (Thermo Scientific), 4 nmol dNTPs and 10 pmol of each primer (PM1+ sense and PM1- antisense). For the second round, 2.5 µl of PCR product from the first round was amplified in a 25-μl final volume using 0.5 U Phusion Green hot start high-fidelity polymerase, 5 nmol of dNTPs and 10 pmol of each primer (BKV+ sense and PM2- antisense). The cycling conditions were: 98°C for 30 s, 30 cycles: 98°C for 10 s, 60°C for 30 s (1st round)/55°C for 30 s (2nd round), 72°C for 30 s and a final extension at 72°C for 5 min.

One hundred and eleven tissue samples from different renal neoplasms (adenomas, angiomyolipomas, oncocytomas, leiomyosarcoma and renocellular carcinomas), 3 kidney biopsy samples and 76 bladder carcinoma tissue samples were studied for the presence of HPyV9, WU, KI and BK. The novel HPyVs were not detected in any of the samples and BKPyV positivity was found in one kidney biopsy sample from a renal transplant patient. However, PCR-amplifiable DNA was extracted from each tissue sample.

Although the prevalence of KIPyV and WUPyV in different tumours was investigated and published previously by some research teams, with the exception of one study, no association of these viruses and tumours was revealed. In total, 37 and 38 formalin-fixed paraffin-embedded, mucosal melanoma samples [45,55], 25 fresh-frozen, central nervous system tumours, 31 fresh-frozen, neuroblastoma samples [46], 50 neonatal, dried blood spots from children who developed later acute lymphoblastic leukaemia [50], 43 formalin-fixed paraffin-embedded neuroendocrine tumour samples [48], 30 fresh lung adenocarcinomas [49] and 32 neuroendocrine lung tumours [47] were found to be negative for KIPyV and WUPyV DNA by standard [45,46,47], nested [50], real-time PCR [49] and polyomavirus genotyping assay [48]. Babakir-Mina et al. [63] detected the VP1 region of KIPyV in 9 out of 40 fresh lung cancer tissue samples, although only 2 malignant tissue samples were positive for the early region of KI virus. These results revealed that the lung can be the site of infection, even if the infected cell type was not identified. In another study, CD68+ cells in lung were found to be positive for the KIPyV antigen, suggesting that alveolar macrophages might be the site of KIPyV infection [64]. Based on these data it cannot be concluded that KIPyV has any role in oncogenesis.

HPyV9 was examined but not detected in different non-Merkel cell carcinoma skin cancers (paraffin-embedded: 41 basal cell carcinoma, 31 actinic keratosis, 8 in situ squamous cell carcinoma, 52 squamous cell carcinoma, 42 keratoacanthoma, 5 microcystic adnexal carcinoma and 14 atypical fibroxanthoma) [51], 37 mucosal melanoma samples [55], 39 skin and blood samples from patients with cutaneous T-cell lymphoma [54], 31 formalin-fixed paraffin-embedded samples and 8 frozen samples from patients with glioblastoma multiforme [57], and 27 serum samples from patients with chronic lymphocytic leukaemia [52] by real-time PCR. HPyV9 DNA was found by deep sequencing in a skin sample from a patient with Merkel cell carcinoma [53]. Low-quantity HPyV9 DNA was detected in 1 out of the 18 paraffin-embedded melanoma samples examined [56].

The potential role of BKPyV in the development of bladder, renal and other carcinomas has been reviewed extensively [1,2,3,19]. The virus is ubiquitous with primary infections occurring during childhood, and the seropositivity among adults exceeds 90%. The transmission is suggested to be respiratory, faecal-oral, urinary route, transplacental and even through blood transfusion and organ transplantation [2]. After the primary infection, lifelong persistence is established, mainly in the urinary tract [65,66]. Active, lytic viral replication occurs in 5-10% of healthy individuals, resulting in virus shedding via urine, but is more frequent in the immunocompromised (such as renal transplant patients) and is in accordance with the rate of the immunosuppression [67,68]. BKPyV is able to induce malignant transformation in animals and in in vitro cell cultures, but studies with human cancers are controversial. The presence or absence of BKPyV DNA and/or proteins has been reported, hence the role of this virus in human tumourigenesis is not clarified, as reviewed previously [1,3,19].

In our study, BKPyV DNA was not detected in benign and malignant renal neoplasia (0/111) and also not in bladder cancer (0/76). Nucleic acid extraction was successful, resulting in a good quantity of amplifiable DNA, and previously used PCR detection methods with good sensitivity levels were used (table 2). In addition, 1 out of the 3 examined renal biopsy samples was BKPyV DNA positive. Antigen expression was not examined.

Based on our data and previous studies, there is no evidence that WUPyV, KIPyV or HPyV9 have any role in oncogenesis; however, this cannot be definitively excluded. Although all three viruses have previously been detected in urine samples, there is no evidence that these viruses infect the urinary tract. Despite the growing number of prevalence data, little or hardly anything is known about the pathogenesis of KIPyV, WUPyV and HPyV9. The cited studies and our new results provide essential data regarding the prevalence of novel HPyVs, but more samples and studies are needed. Identifying the susceptible cells, sites of infection and possible latencies, as well as the isolation of the virions and further in vitro studies are necessary for further progression.

The research presented here was supported by the Hungarian Scientific Research Fund (OTKA- PD109108) and the research activity of Eszter Csoma was supported by the European Union and the State of Hungary, co-financed by the European Social Fund in the framework of the TÁMOP-4.2.4.A/2-11/1-2012-0001 National Excellence Program.

The authors have no conflicts of interest to disclose.