Introduction: Oncolytic virotherapy is a novel strategy for cancer treatment in humans and companion animals. Canine distemper virus (CDV) is known to induce apoptosis in tumor cells, thus serving as a potential candidate for oncolytic therapy. However, the mechanism of viral oncolytic activity is less studied and varies depending on the type of cancer and cell lines. Methods: In the present study, the susceptibility of the MCF-7 cell line to CDV infection was assessed using the CDV strain, which was confirmed previously through sequence analysis in the Vero cell line. The impact of CDV infection on cell proliferation and apoptosis was studied by evaluating the expression of four target genes including the myeloid cell leukemia 1 (MCL-1), phosphoinositide-3-kinase regulatory subunit 1 (PIK3R1), transcription factor (SP1), and DNA (cytosine-5)-methyltransferase 3A (DNMT3A). Results: CDV replication in the cells induced cytopathic effect and decreased in the cell proliferation rates compared to the uninfected control. MCL-1, SP1, and PIK3R1 gene expression was down-regulated, while the expression of DNMT3A was up-regulated 3 days post-infection. The expression levels of the target genes suggest that CDV may be inducing the intrinsic apoptotic pathway in the cancer cell line. Conclusion: Overall, the results strongly propose CDV strain as a potential candidate for cancer therapy after detailed studies.

Various kinds of cancer therapies such as chemotherapy, radiotherapy, immunotherapy are being developed and used, each with their advantages and disadvantages. Oncolytic virotherapy is also a type of cancer therapy where oncolytic viruses that specifically infect and damage cancer tissues are being used. Canine distemper virus (CDV) is a negative stranded RNA virus of the Morbillivirus genus of the Paramyxoviridae family. CDVs are predicted to be a potential treatment for human and animal neoplasias [1, 2]. The virus has been reported to cause cytopathic effects (CPEs) and persistent infection in vivo as well as in vitro in a number of cell lines [3, 4].

Oncolytic viruses kill infected cancer cells in different ways, such as virus-mediated cytotoxicity, cytotoxic immune effector, lysis of cancer cells and induction of host anti-tumor immunity, and apoptosis. Apoptosis regulated cell death in multicellular organisms, which plays a critical role in homeostasis, cell replacement, and damaged cell removal [5]. Apoptotic pathway involves activation of caspases, pro-apoptotic genes and it proceeds mainly through the extrinsic and intrinsic pathways. The process also includes the inhibition of anti-apoptotic proteins. The intrinsic pathways are mainly driven by the imbalance of the pro- and anti-apoptotic proteins in the cytosol and mitochondria, leading to a cascade of reactions, while the extrinsic pathway initiates with the activation of caspase-8 by the ligand interaction with death receptors [6]. Thus, cells ultimately undergo degradation of the critical cellular proteins by the caspases and apoptotic cellular death.

Apoptosis is either induced or inhibited by viral infections. Many viral proteins have an impact on the cellular pathways that regulate apoptosis and cell proliferation. Few of the viral proteins activate apoptosis as a part of host defense, while few others inhibit the cell apoptotic death [7]. Apoptosis induction or inhibition is a way of defense against the host and a virus infection mechanism to spread in the neighboring cells by the virus [8, 9].

CDV has been reported to induce apoptosis via the extrinsic pathway in cerebellum and lymphoid tissues by activating the caspase-8 and -3 expression [10, 11]. In addition, it was observed that CDV causes apoptosis of Vero cells, also by triggering the extrinsic pathway by activating the caspase-8 and caspase-3 [12, 13]. CDV is able to infect canine and human cell lines in vitro including lymphoid cell lines, tumor cell lines such as DH82 cells, MCF-7 cells, HeLa cells, and neoplastic lymphocytes leading to apoptosis [3, 14‒16]. Apoptosis induced by cellular stress due to CDV infection in cancerous cells may represent an attractive alternative for cancer treatment.

The present study was conducted with the aim to determine the influence of CDV infection on breast cancer cell line and study the changes in expression level of selected genes involved in regulation of cellular growth and proliferation. The outcomes of the study would also determine the effect of CDV on apoptosis induction or inhibition on the cancer cells and its infection-related association with MCL-1 (myeloid cell leukemia 1), PIK3R1 (phosphoinositide-3-kinase regulatory subunit 1), SP1 (transcription factor), and DNMT3A (DNA [cytosine-5]-methyltransferase 3 alpha) gene expression. In the last decade, these genes have been reported to have a role in viral infection and apoptosis.

Cell Culture

Cell line MCF-7 (Michigan Cancer Foundation-7) was procured from NCCS, Pune, and cultured in Dulbecco’s Modified Eagle Medium, antibiotic-antimycotic 100×, and 10% fetal bovine serum (Invitrogen, USA). In this growth medium, the cells were incubated at 37 °C and 5% CO2 until 80% monolayer confluence was achieved. The growth media in the flasks were replaced every 2-3 days, and the cells were observed for morphology using the EVOS FL Color Imaging System (Life Technologies, USA).

CDV Infection and Proliferation

The CDV strain was used for primary infection and growth in MCF-7. The CDV strain used for infection in the study was previously confirmed by sequence analysis of the viruses primarily cultured in VERO-dSLAM cells. In the present study, for virus infection, MCF-7 cells (106 per well) were seeded into 12-well plates and infected with 100 μL of CDV suspensions (106.01 TCID50 mL−1), corresponding to a multiplicity of infection of approximately 2. Uninfected cells served as the negative control. The viral suspensions with 50 μL of only Dulbecco’s Modified Eagle Medium were incubated 1 h at 37 °C for adsorption to cells. After incubation, wells were supplemented with the formerly mentioned growth medium. Infected and uninfected (control) cells were monitored for CPE at day 1, 2, 3, and 5 post-infection using phase-contrast microscope (Olympus IX-70). All observations were done in duplicate. Multiple fields were analyzed each time and observations were documented. The cells from each day post-infection were processed for RNA extraction and real-time PCR procedures.

RNA Isolation and Reverse Transcription

After CDV infection, MCF-7 cells were washed with sterile 1x PBS. Total RNA was isolated using RNeasy Mini Kit (Qiagen, Germany) following the manufacturer's protocol. RNA was quantified using RNA HS Assay kit in Qubit 4.0 (Thermo Fisher Scientific, USA). RNA samples were stored at −80 °C until further use. The multiplicity of the virus post-infection was assessed by rt-PCR using the PP-II primers [forward: AACTATGTATCCGGCTCTTGG, reverse: CGAGTCTGAAGTAAGCTGGG] that are specific to the CDV (Frisk et al. [29]). First-strand complementary DNA was synthesized from 2 μg total RNA using the high capacity complementary DNA synthesis kit (Invitrogen, USA). After denaturing the RNA template, primers were incubated at 65 °C for 5 min. The reaction mixture (20 μL) was incubated at 37 °C for 2 h, enzyme inactivated at 85 °C for 5 min and used for qPCR.

Expression Study by qPCR

Real-time PCR was carried out in an ABI 7500 Sequence Detection System (Applied Biosystems, USA) using the Power Sybr® Green Master Mix Kit (Invitrogen). All samples were run in triplicates against the targets mentioned in Table 1. The parameters used for PCR were 1 cycle at 50 °C for 2 min, 1 cycle at 95 °C for 10 min, 40 cycles at 95 °C for 15 s and 60 °C for 1 min. ACTB (β-actin) was used as the endogenous control for the study. The data were obtained from three replicates of each sample. Quantification of gene expression was performed by the 2−ΔΔCt method and normalized with the endogenous control (β-actin).

Table 1.

List of primers used for expression study

Primer name5′ sequence 3′Bases, nProduct lengthTargetReference
PIK3R1-L-F TGG​ACG​GCG​AAG​TAA​AGC​ATT 21 154 Homo sapiens phosphoinositide-3-kinase regulatory subunit 1 (PIK3R1), transcript variant 3, mRNA Lin et al. [30
PIK3R1-L-R AGT​GTG​ACA​TTG​AGG​GAG​TCG 21 
SP1-L-F TTG​AAA​AAG​GAG​TTG​GTG​GC 20 283 Homo sapiens Sp1 transcription factor (SP1), transcript variant 3, mRNA Tominaga et al. [31
SP1-L-R TGC​TGG​TTC​TGT​AAG​TTG​GG 20 
DNMT3A-F TAT​TGA​TGA​GCG​GCA​CAA​GAG​AGC 24 112 Homo sapiens DNA methyltransferase 3 alpha (DNMT3A), transcript variant 3, mRNA Zhu et al. [32
DNMT3A-R GGG​TGT​TCC​AGG​GTA​ACA​TTG​AG 23 
MCL-1-F CCA​AGA​AAG​CTG​CAT​CGA​ACC​AT 23 151 Homo sapiens MCL-1 apoptosis regulator, BCL2 family member (MCL-1), transcript variant 1, mRNA Yu et al. [33
MCL-1-R CAG​CAC​ATT​CCT​GAT​GCC​ACC 21 
ACTB-F CCAACCGCGAGAAGATGA 18 97 Homo sapiens actin beta (ACTB), mRNA Moretti et al. [34
ACTB-R CCA​GAG​GCG​TAC​AGG​GAT​AG 20 
Primer name5′ sequence 3′Bases, nProduct lengthTargetReference
PIK3R1-L-F TGG​ACG​GCG​AAG​TAA​AGC​ATT 21 154 Homo sapiens phosphoinositide-3-kinase regulatory subunit 1 (PIK3R1), transcript variant 3, mRNA Lin et al. [30
PIK3R1-L-R AGT​GTG​ACA​TTG​AGG​GAG​TCG 21 
SP1-L-F TTG​AAA​AAG​GAG​TTG​GTG​GC 20 283 Homo sapiens Sp1 transcription factor (SP1), transcript variant 3, mRNA Tominaga et al. [31
SP1-L-R TGC​TGG​TTC​TGT​AAG​TTG​GG 20 
DNMT3A-F TAT​TGA​TGA​GCG​GCA​CAA​GAG​AGC 24 112 Homo sapiens DNA methyltransferase 3 alpha (DNMT3A), transcript variant 3, mRNA Zhu et al. [32
DNMT3A-R GGG​TGT​TCC​AGG​GTA​ACA​TTG​AG 23 
MCL-1-F CCA​AGA​AAG​CTG​CAT​CGA​ACC​AT 23 151 Homo sapiens MCL-1 apoptosis regulator, BCL2 family member (MCL-1), transcript variant 1, mRNA Yu et al. [33
MCL-1-R CAG​CAC​ATT​CCT​GAT​GCC​ACC 21 
ACTB-F CCAACCGCGAGAAGATGA 18 97 Homo sapiens actin beta (ACTB), mRNA Moretti et al. [34
ACTB-R CCA​GAG​GCG​TAC​AGG​GAT​AG 20 

Statistical Analysis

Data were depicted as mean ± standard deviation. All statistical analysis was performed in Prism software v.6.1 (GraphPad, USA). Gene expression was depicted as fold change.

CDV Infection and Apoptosis

MCF-7 cells showed hampered growth after 24 h of infection and presented CPE after 72 h of inoculation with the CDV strain. The infected cells showed a significant decrease in cell proliferation rate post-CDV infection. The CPE was observed in the form of cell lysis,floating rounded cell clumps and bigger cells (Fig. 1). The CPE was not that densely observed as also expected from earlier reports on CDV infection in MCF-7. The multiplicity of virus was also checked using rt-PCR for a change in Ct value depicting the multiplication of viral copies and significant increase in the viral load was observed 5 days post-infection.

Fig. 1.

a Control uninfected MCF-7 cells 72 h post-infection as negative control; CPEs produced by CDV strain at 72 h (b) and 120 h (c) revealed few rounded,floating cells and decreased cell proliferation.

Fig. 1.

a Control uninfected MCF-7 cells 72 h post-infection as negative control; CPEs produced by CDV strain at 72 h (b) and 120 h (c) revealed few rounded,floating cells and decreased cell proliferation.

Close modal

Expression Study by qPCR

Real-time PCR was performed using gene-specific primers for the MCL-1, SP1, PIK3-R, and DNMT3A to check their mRNA expression levels in the infected cells and uninfected MCF-7 cells. β-Actin was used as the endogenous control. The mRNA expressions of MCL-1, SP1, and PIK3R1 were observed to be down-regulated in the infected cells compared to the uninfected cells (Fig. 2). There was ∼2-fold decrease in the MCL-1 and SP1 expression, while PIK3-R showed almost negligible expression after 72 h of infection. On the contrary, the expression levels of DNMT3A were up-regulated by more than 2-fold from day 3 post-infection onwards. The results defined the role of CDV in the apoptosis pathway and resulting cell death of the cancerous tumor.

Fig. 2.

rt-PCR expression analysis of the target genes in the infected cells at day 1, day 3, and day 5 post-infection compared to the uninfected cells ([dCt] deltaCt was normalized by the Ct value of endogenous control [beta-actin]).

Fig. 2.

rt-PCR expression analysis of the target genes in the infected cells at day 1, day 3, and day 5 post-infection compared to the uninfected cells ([dCt] deltaCt was normalized by the Ct value of endogenous control [beta-actin]).

Close modal

The members of Morbillivirus genus-like CDV have prospective CPEs for canine and human breast carcinoma. Human ductal breast cancer is an early form of cancer, which can lead to uncontrollable invasive cancer. Hence, it will be a notably efficient approach to target the ductal cancer with a possible new approach like virotherapy. The infective strategy for CDV to kill the ductal breast tumor is possibly through the entry by nectin/PVRL4 in breast tumors. Importantly, PVRL4 expression in normal cells is absent [17]. The deregulation of PI3K signaling pathway is widely reported in breast cancer as also supported by our study. Interestingly, a down-regulated expression of PIK3R1 was observed in CDV-infected human ductal breast cancer cell line (MCF-7). The under-expression of PIK3R1 could be associated with accumulation of other changes, which are associated in the PI3K/AKT pathway, including under-expression of EGFR, AKT3, PTEN, WEE1 [18], and other genes by the viral infection. Based on the results observed, CDV entering through the nectin/PVRL4 may be involved in down-regulating PIK3R1 following the AKT pathway and regulating other downstream genes in the ductal breast tumor (Fig. 3). Thus, CDV is inhibiting the crucial intracellular cell signaling transduction pathway that stimulates cell survival, proliferation, metabolism, growth, and angiogenesis.

Fig. 3.

Possible mechanism of action of CDV as oncolytic virus in MCF7 cells.

Fig. 3.

Possible mechanism of action of CDV as oncolytic virus in MCF7 cells.

Close modal

Further, results revealed the down-regulation of MCL-1, which is characterized as a survival factor for normal and malignant tissues [19]. MCL-1 has been investigated to be an important apoptotic regulator of cells through intrinsic and extrinsic pathways of mitochondria and granzyme B in ductal breast tumors [20, 21]. MCL-1 interacts with pro-apoptotic and anti-apoptotic proteins based on exogenous stimulus leading to programmed cell death and cell survival, respectively. MCL-1 is also reported in nucleus where it regulates the activation of CDK1, PCNA, and CHK1 resulting in cell cycle progression and DNA damage [9]. The up-regulation of MCL-1 in ductal carcinoma is being reported in our study also, in consistency with the study of Young et al. [21]. In the infected cells, MCL-1 was observed to be under-expressed postulating the role of CDV in apoptosis of the ductal breast tumor. As stated above, the under-expression of PIK3R1 could also be a reasonable explanation of under-expression of MCL-1. Hence, CDV could be acting as a key player in apoptosis through an intrinsic (mitochondrial) pathway in the ductal breast tumor as reported in cervical tumor by Del Puerto et al. [22]. However, if any other cascades of apoptosis are playing a role in breast tumor by CDV is yet to be elucidated.

DNMT3A (DNA-methyltransferase 3 alpha) is involved in the de novo methylation of either hemimethylated or unmethylated DNA to facilitate cell maintenance [23]. DNMT3A binds on CpG island of promoter region where methylation by DNMT3A on promoter region results into suppressive activity of gene transcription [24]. Surprisingly, a higher over-expressive effect of DNMT3A in CDV-infected MCF-7 cells was observed. The over-expression of DNMT3A stipulates the functional role of CDV in ductal breast cancer as diminishing the activity of transcription of various genes that are involved in cell progression, cell survival, metabolism, and growth. Here, the over-expressive effect of DNMT3A by CDV in the ductal breast tumor could be indirectly affecting the under-expression of other genes in our study as SP1 following PIK3R1 and MCL-1. Possibly, CDV might also be directly interacting with individual genes for which further investigation is under study.

Specificity protein 1 (SP1) is a zinc-finger-like transcriptional activator protein that is ubiquitously expressed in cells [25]. The functional role of SP1 is featured in various biological processes, including cell progression and cell proliferation [26]. Recently, SP1 is reported as transcriptional regulator in breast cancer where DNMT3A methylation is followed by binding of SP1 to the promoter site, resulting in abrogated gene expression [24]. Consistently, in our study we also found down-regulation of SP1 in CDV-infected MCF-7 cell line, indicating the role of CDV in silencing of SP1 protein and thus abolishing the activity of proliferation and progression of ductal breast tumor cells. Additionally, Measles virus (member of Pyromixiviridae family) is also reported to be down-regulating the activity of SP1 [27]. On the contrary, SP1 was found to be up-regulated in human cytomegalovirus infection indicating the differential effect on SP1 by different families of virus [28]. Overall, CDV might be playing a crucial role in inhibiting the ductal breast tumor by suppressing its invasive property and ultimately leading to death of the tumor cells.

Ethical approval is not required for this study in accordance with local or national guidelines. Ethical approval and consent were not required as this study was based on publicly available data.

The authors report there are no conflicts of interests to declare.

This work was funded by Gujarat Biotechnology Research Centre, Department of Science and Technology, Government of Gujarat, India.

D.J. and N.N. performed experiments, wrote manuscript, and reviewed it. M.J. helped in experimental design. A.K. helped in experimental design, data analysis, and critical review of manuscript. C.J. conceptualized the work, analyzed the data, and reviewed the manuscript.

All data generated or analyzed during this study are included in this article.

1.
Arendt
M
,
Nasir
L
,
Morgan
IM
.
Oncolytic gene therapy for canine cancers: teaching old dog viruses new tricks
.
Vet Comp Oncol
.
2009
;
7
(
3
):
153
61
.
2.
Garcia
JA
,
Ferreira
HL
,
Vieira
FV
,
Gameiro
R
,
Andrade
AL
,
Eugênio
FR
.
Tumour necrosis factor-alpha-induced protein 8 (TNFAIP8) expression associated with cell survival and death in cancer cell lines infected with canine distemper virus
.
Vet Comp Oncol
.
2017
;
15
(
2
):
336
44
.
3.
Pillet
S
,
von Messling
V
.
Canine distemper virus selectively inhibits apoptosis progression in infected immune cells
.
J Virol
.
2009
;
83
(
12
):
6279
87
.
4.
Moro
L
,
Martins
AS
,
Alves
CM
,
Santos
FG
,
Del Puerto
HL
,
Vasconcelos
AC
.
Apoptosis in the cerebellum of dogs with distemper
.
J Vet Med B Infect Dis Vet Public Health
.
2003
;
50
(
5
):
221
5
.
5.
Rudin
CM
,
Thompson
CB
.
Apoptosis and disease: regulation and clinical relevance of programmed cell death
.
Annu Rev Med
.
1997
;
48
:
267
81
.
6.
Adams
JM
.
Ways of dying: multiple pathways to apoptosis
.
Genes Dev
.
2003
;
17
(
20
):
2481
95
.
7.
Kowalczyk
AM
,
Roeder
GE
,
Green
K
,
Stephens
DJ
,
Gaston
K
.
Measuring the induction or inhibition of apoptosis by HPV proteins
.
Methods Mol Med
.
2005
;
119
:
419
32
.
8.
Best
SM
.
Viral subversion of apoptotic enzymes: escape from death row
.
Annu Rev Microbiol
.
2008
;
62
:
171
92
.
9.
Del Puerto
HL
,
Martins
AS
,
Milsted
A
,
Souza-Fagundes
EM
,
Braz
GF
,
Hissa
B
.
Canine distemper virus induces apoptosis in cervical tumor derived cell lines
.
Virol J
.
2011
;
8
:
334
.
10.
Moro
L
,
de Sousa Martins
A
,
de Moraes Alves
C
,
de Araújo Santos
FG
,
dos Santos Nunes
JE
,
Carneiro
RA
.
Apoptosis in canine distemper
.
Arch Virol
.
2003
;
148
(
1
):
153
64
.
11.
Del Puerto
HL
,
Martins
AS
,
Moro
L
,
Milsted
A
,
Alves
F
,
Braz
GF
.
Caspase-3/-8/-9, Bax and Bcl-2 expression in the cerebellum, lymph nodes and leukocytes of dogs naturally infected with canine distemper virus
.
Genet Mol Res
.
2010
;
9
(
1
):
151
61
.
12.
Guo
A
,
Lu
C
.
Canine distemper virus causes apoptosis of Vero cells
.
J Vet Med B Infect Dis Vet Public Health
.
2000
;
47
(
3
):
183
90
.
13.
Kajita
M
,
Katayama
H
,
Murata
T
,
Kai
C
,
Hori
M
,
Ozaki
H
.
Canine distemper virus induces apoptosis through caspase-3 and -8 activation in Vero cells
.
J Vet Med B Infect Dis Vet Public Health
.
2006
;
53
(
6
):
273
7
.
14.
Schobesberger
M
,
Summerfield
A
,
Doherr
MG
,
Zurbriggen
A
,
Griot
C
.
Canine distemper virus-induced depletion of uninfected lymphocytes is associated with apoptosis
.
Vet Immunol Immunopathol
.
2005
104
1–2
33
44
.
15.
Puff
C
,
Krudewig
C
,
Imbschweiler
I
,
Baumgärtner
W
,
Alldinger
S
.
Influence of persistent canine distemper virus infection on expression of RECK, matrix-metalloproteinases and their inhibitors in a canine macrophage/monocytic tumour cell line (DH82)
.
Vet J
.
2009
;
182
(
1
):
100
7
.
16.
Suter
SE
,
Chein
MB
,
von Messling
V
,
Yip
B
,
Cattaneo
R
,
Vernau
W
.
In vitro canine distemper virus infection of canine lymphoid cells: a prelude to oncolytic therapy for lymphoma
.
Clin Cancer Res
.
2005
;
11
(
4
):
1579
87
.
17.
Fabre-Lafay
S
,
Monville
F
,
Garrido-Urbani
S
,
Berruyer-Pouyet
C
,
Ginestier
C
,
Reymond
N
.
Nectin-4 is a new histological and serological tumor associated marker for breast cancer
.
BMC cancer
.
2007
;
7
:
73
.
18.
Cizkova
M
,
Vacher
S
,
Meseure
D
,
Trassard
M
,
Susini
A
,
Mlcuchova
D
.
PIK3R1 underexpression is an independent prognostic marker in breast cancer
.
BMC cancer
.
2013
;
13
:
545
.
19.
Perciavalle
RM
,
Opferman
JT
.
Delving deeper: MCL-1’s contributions to normal and cancer biology
.
Trends Cell Biol
.
2013
;
23
(
1
):
22
9
.
20.
Hu
SX
,
Wang
S
,
Wang
JP
,
Mills
GB
,
Zhou
Y
,
Xu
HJ
.
Expression of endogenous granzyme B in a subset of human primary breast carcinomas
.
Br J Cancer
.
2003
;
89
(
1
):
135
9
.
21.
Young
AI
,
Law
AM
,
Castillo
L
,
Chong
S
,
Cullen
HD
,
Koehler
M
.
MCL-1 inhibition provides a new way to suppress breast cancer metastasis and increase sensitivity to dasatinib
.
Breast Cancer Res
.
2016
;
18
(
1
):
125
.
22.
Jamil
S
,
Stoica
C
,
Hackett
TL
,
Duronio
V
.
MCL-1 localizes to sites of DNA damage and regulates DNA damage response
.
Cell Cycle
.
2010
;
9
(
14
):
2843
55
.
23.
Jackson
M
,
Krassowska
A
,
Gilbert
N
,
Chevassut
T
,
Forrester
L
,
Ansell
J
.
Severe global DNA hypomethylation blocks differentiation and induces histone hyperacetylation in embryonic stem cells
.
Mol Cell Biol
.
2004
;
24
(
20
):
8862
71
.
24.
Tian
HP
,
Lun
SM
,
Huang
HJ
,
He
R
,
Kong
PZ
,
Wang
QS
.
DNA methylation affects the SP1-regulated transcription of FOXF2 in breast cancer cells
.
J Biol Chem
.
2015
;
290
(
31
):
19173
83
.
25.
Narayan
VA
,
Kriwacki
RW
,
Caradonna
JP
.
Structures of zinc finger domains from transcription factor Sp1. Insights into sequence-specific protein-DNA recognition
.
J Biol Chem
.
1997
;
272
(
12
):
7801
9
.
26.
Abdelrahim
M
,
Samudio
I
,
Smith
R
3rd
,
Burghardt
R
,
Safe
S
.
Small inhibitory RNA duplexes for Sp1 mRNA block basal and estrogen-induced gene expression and cell cycle progression in MCF-7 breast cancer cells
.
J Biol Chem
.
2002
;
277
(
32
):
28815
22
.
27.
Sato
H
,
Yoneda
M
,
Honma
R
,
Ikeda
F
,
Watanabe
S
,
Kai
C
.
Measles virus infection inactivates cellular protein phosphatase 5 with consequent suppression of Sp1 and c-myc activities
.
J Virol
.
2015
;
89
(
19
):
9709
18
.
28.
Yurochko
AD
,
Mayo
MW
,
Poma
EE
,
Baldwin
AS
Jr
,
Huang
ES
.
Induction of the transcription factor Sp1 during human cytomegalovirus infection mediates upregulation of the p65 and p105/p50 NF-kappaB promoters
.
J Virol
.
1997
;
71
(
6
):
4638
48
.
29.
Frisk
AL
,
König
M
,
Moritz
A
,
Baumgärtner
W
.
Detection of canine distemper virus nucleoprotein RNA by reverse transcription-PCR using serum, whole blood, and cerebrospinal fluid from dogs with distemper
.
J Clin Microbiol
.
1999
Nov 1;
37
11
3634
43
.
30.
Lin
Y
,
Yang
Z
,
Xu
A
,
Dong
P
,
Huang
Y
,
Liu
H
.
PIK3R1 negatively regulates the epithelial-mesenchymal transition and stem-like phenotype of renal cancer cells through the AKT/GSK3β/CTNNB1 signaling pathway
.
Sci Rep
.
2015
Mar 11;
5
1
8997
.
31.
Tominaga
T
,
Tsuchiya
T
,
Mochinaga
K
,
Arai
J
,
Yamasaki
N
,
Matsumoto
K
.
Epidermal growth factor signals regulate dihydropyrimidine dehydrogenase expression in EGFR-mutated non-small-cell lung cancer
.
BMC Cancer
.
2016
Dec;
16
354
9
.
32.
Zhu
X
,
Mao
X
,
Hurren
R
,
Schimmer
AD
,
Ezzat
S
,
Asa
SL
.
Deoxyribonucleic acid methyltransferase 3B promotes epigenetic silencing through histone 3 chromatin modifications in pituitary cells
.
J Clin Endocrinol Metab
.
2008
Sep 1;
93
9
3610
7
.
33.
Yu
Q
,
Hu
Z
,
Shen
Y
,
Jiang
Y
,
Pan
P
,
Hou
T
.
Gossypol inhibits cullin neddylation by targeting SAG-CUL5 and RBX1-CUL1 complexes
.
Neoplasia
.
2020
Apr 1;
22
4
179
91
.
34.
Moretti
D
,
Del Bello
B
,
Cosci
E
,
Biagioli
M
,
Miracco
C
,
Maellaro
E
.
Novel variants of muscle calpain 3 identified in human melanoma cells: cisplatin-induced changes in vitro and differential expression in melanocytic lesions
.
Carcinogenesis
.
2009
Jun 1;
30
6
960
7
.