Background/Aims: Lithium, a widely used drug for the treatment of mood disorders, has previously been shown to stimulate the release of fibroblast growth factor FGF23, a powerful regulator of 1,25(OH)2D3 formation and mineral metabolism. The cellular mechanisms involved have remained elusive. Lithium has been shown to modify Ca2+ signaling. In a wide variety of cells, Ca2+ entry is accomplished by the pore-forming Ca2+ channel subunit Orai1 and its regulator STIM, which stimulates Orai following Ca2+ depletion of intracellular stores. Transcription factors promoting Orai1 expression include NF-κB. The present study thus explored whether the effect of lithium on FGF23 involves and requires Ca2+ entry. Methods: Experiments were performed in UMR106 osteoblastic cells and immortalized primary osteoblasts (IPO). FGF23 and Orai1 transcript levels were estimated from qRT-PCR, cytosolic Ca2+ concentration ([Ca2+]i) from Fura2 fluorescence and store-operated Ca2+ entry (SOCE) from an increase in [Ca2+]i following store depletion by inhibition of the sarcoendoplasmatic Ca2+ ATPase (SERCA) with thapsigargin (1 µM). Results: SOCE in UMR106 cells was enhanced by lithium treatment, an effect abrogated by Orai1 inhibitor 2-APB (50 µM). FGF23 transcript levels were increased by lithium and inhibited by Orai1 inhibitors 2-APB (50 µM) and YM58483 (100 nM) as well as NF-κB inhibitors wogonin (100 µM) and withaferin A (500 nM). Moreover, Orai1 transcript levels were up-regulated by lithium, an effect attenuated by wogonin and withaferin A. Conclusion: Lithium stimulates FGF23 release at least in part by NF-κB dependent up-regulation of Orai1 transcription and store operated Ca2+ entry.

FGF23 (fibroblast growth factor 23), a bone-derived regulator of calcium phosphate metabolism [1,2] reduces the formation and enhances the inactivation of 1,25-dihydroxyvitamin D3 (1,25(OH)2D3) by down-regulation of renal 1α hydroxylase (Cyp27b1) and up-regulation of 25-hydroxyvitamin D 24-hydroxylase (Cyp24) [3,4,5,6], respectively. FGF23 thus decreases the serum levels of 1,25(OH)2D3[5,6,7,8,9,10,11,12], a powerful regulator of renal and intestinal phosphate and calcium transport [13,14,15,16]. FGF23 inhibits renal tubular phosphate reabsorption [2,5,7,8,10,11,12,17] and fosters renal phosphate elimination [5,7,8,10,11,12]. FGF23 deficiency results in greatly elevated serum phosphate, calcium, and 1,25(OH)2D3 levels, effects eventually resulting in rapid aging and a dramatic reduction of lifespan in part due to excessive vascular calcification [4,12,18,19,20,21].

For its renal effects, FGF23 requires Klotho as a co-receptor [22,23,24]. Mice lacking functional Klotho similarly suffer from multiple age-related disorders and decreased life span resulting from extensive soft tissue calcification [23,25,26,27,28,29,30,31,32,33,34,35,36,37,38,39]. The effects of Klotho deficiency are also largely due to increased 1,25(OH)2D3 formation, enhanced renal tubular phosphate reabsorption and increased serum phosphate levels [40,41,42]. As a matter of fact, hyperphosphatemia fosters vascular calcification [43] and is considered a predictor of mortality [44].

FGF23 release is stimulated by 1,25(OH)2D3 [45,46]. Further stimulators of FGF23 formation in osteoblasts include PHEX (phosphate-regulating gene with homology to endopeptidase) and DMP-1 (dentin matrix protein or cyclin D binding myb-like protein 1), sustained phosphate load even in the absence of hyperphosphatemia, increased extracellular Ca2+ concentration and parathyroid hormone [45].

Recent observations revealed that FGF23 release is stimulated by lithium [47], which is widely used in the treatment of bipolar disorders and Alzheimer's disease [48,49,50]. Cellular mechanisms sensitive to lithium include Ca2+ oscillations, which are triggered by release of Ca2+ from intracellular stores [51]. Store-operated Ca2+ entry [52] may be accomplished by the 4-transmembrane-spanning pore forming calcium release-activated channel (CRAC) moiety Orai1 (CRACM1), which mediates entry of extracellular Ca2+[53,54,55], and stromal interaction molecule 1 (STIM1), an Orai1-regulating Ca2+ sensor predominantly expressed in the endoplasmatic reticulum (ER) [56,57,58].

The present study explored whether lithium modifies the cytosolic Ca2+ concentration in FGF23-producing UMR106 osteoblast-like cells [59] and whether cytosolic Ca2+ impacts on FGF23 formation in these cells.

Cell culture

UMR106 rat osteosarcoma cells were cultured in DMEM high glucose medium supplemented with 10% FCS and 1% penicillin/streptomycin under standard cell culturing conditions. Human immortalized primary periosteal cells (IPO) [60] were cultured in DMEM F-12 (1:1 mixture of DMEM and Ham's F-12, high glucose) containing Glutamax and 10% FCS and 1% penicillin/streptomycin/1% fungizide. The cells were pretreated for 24 h with 100 nM 1,25(OH)2D3 (Sigma, Schnelldorf, Germany) and subsequently with 2 mM LiCl (Lithium) (Calbiochem, Darmstadt, Germany) with or without 50 ìM Orai inhibitor 2-APB (TOCRIS, Bristol, UK), 100 nM Orai inhibitor YM58483 (TOCRIS), 500 nM NFκB inhibitor withaferin A (TOCRIS), or 100 µM NFκB inhibitor wogonin (Sigma) for another 24 h.

Quantative Real Time-PCR (qRT-PCR)

Total RNA was isolated with TriFast RNA extraction reagent (Peqlab Biotechnologie GmbH, Erlangen, Germany). mRNA was transcribed with SuperScript III Reverse Transcriptase (Invitrogen, Karlsruhe, Germany) using an oligo dT primer. Quantitative RT-PCR was performed on a BioRad iCycler iQ™ Real-Time PCR Detection System (Bio-Rad Laboratories, Munich, Germany) using the following primers:

Rat Tbp (TATA box-binding protein):

forward (5'-3'): ACTCCTGCCACACCAGCC

reverse (5'-3'): GGTCAAGTTTACAGCCAAGATTCA

Rat Fgf23

forward (5'-3'): TGGCCATGTAGACGGAACAC

reverse (5'-3'): GGCCCCTATTATCACTACGGAG

Rat Orai1

forward (5'-3'): CGTCCACAACCTCAACTCC

reverse (5'-3'): AACTGTCGGTCCGTCTTAT

Rat NFκB p65

forward (5'-3'): TTCCCTGAAGTGGAGCTAGGA

reverse (5'-3'): CAGTCGAGGAAGACACTGGA

Human GAPDH

forward (5'-3'): CAACGGATTTGGTCGT

reverse (5'-3'): GACAAGCTTCCCGTTCTCAG

Human Fgf23

forward (5'-3'): TGCTGGCTCCGTAGTGATAA

reverse (5'-3'): TGATGCTTCGGTGACAGGTA

The final volume of the PCR reaction mixture was 20 µl and contained: 2 µl cDNA, 1 µM of each primer, 10 µl GoTaq qPCR Master Mix (Promega, Mannheim, Germany) and sterile water up to 20 µl. qPCR conditions were 95°C for 3 min, followed by 40 cycles of 95°C for 10 s and 58°C for 30 s. Calculated mRNA expression levels were normalized to the expression levels of Tbp of the same cDNA sample. Gene expression was quantified with the ΔΔCT method.

Measurement of intracellular Ca2+

To determine the cytosolic Ca2+ concentration, the cells were loaded with Fura-2/AM (2 µM, Molecular Probes, Goettingen, Germany) for 15 min at 37°C. Fluorescence measurements were carried out with an inverted phase-contrast microscope (Axiovert 100, Zeiss, Oberkochen, Germany). Cells were excited alternatively at 340 or 380 nm and the light was deflected by a dichroic mirror into either the objective (Fluar 40×/1.30 oil, Zeiss, Oberkochen, Germany) or a camera (Proxitronic, Bensheim, Germany). The emitted fluorescence intensity was recorded at 505 nm and data acquisition was accomplished by using specialized computer software (Metafluor, Universal Imaging Downingtown, USA). As a measure for the increase in the cytosolic Ca2+ concentration, the slope and peak of the changes in the 340/380 nm ratio were determined in each experiment.

To determine SOCE, intracellular Ca2+ was measured prior to and following removal of extracellular Ca2+ (and addition of 0.5 mM EDTA), subsequent addition of thapsigagrin (1 µM) and subsequent re-addition of extracellular Ca2+ to the Ringer solution, composed of (in mM): 125 NaCl, 5 KCl, 1.2 MgSO4, 32.2 Hepes, 2 Na2HPO4, 0 or 2 CaCl2 and respectively 0.5 or 0 EGTA, and 5 glucose at pH 7.4 (NaOH).

Immunofluorescence

UMR106 cells treated without or with LiCl and cultured on 4-well chamber slides (Thermo scientific), were washed and fixed with 4% paraformaldehyde for 30 min at room temperature. For blocking unspecific binding, UMR106 cells were incubated with 3% Albumin Fraktion V (Carl Roth, Karlsruhe, Germany), 5% normal goat serum (Sigma, Schnelldorf, Germany), and 0.5% Triton in PBS (PAA, Cölbe, Germany) for 30 min at room temperature. Then, the cells were exposed to rabbit anti-p65 (1:1000, Genetex, Irvine, USA) at 4°C in a humidified chamber overnight. The cells were rinsed four times with PBS and incubated with DyLight® 488-conjugated goat anti-rabbit antibody (1:3000, BIOZOL, Eching, Germany) for 1 h at room temperature. After four washing steps the nuclei were stained with DRAQ-5 dye (1:400; BIOZOL) for 30 min at room temperature. The slides and coverslips were mounted with FluorSave™ Reagent (Calbiochem, Darmstadt, Germany). Images were taken on a LSM 5 EXCITER confocal laser-scanning microscope (Zeiss, Germany) with a water-immersion Plan-Neofluar 40×/1.3 NA differential interference contrast and analyzed with the instruments software.

Statistics

Data are provided as means ± SEM, n represents the number of independent experiments. All data were tested for significance using unpaired Student t-test or ANOVA unless otherwise stated. Only results with p < 0.05 were considered statistically significant.

In order to elucidate the mechanism underlying lithium-sensitive FGF23 release, experiments were performed in UMR106 osteoblast-like cells. As lithium is known to stimulate Ca2+ entry, the cytosolic Ca2+ concentration ([Ca2+]i) was determined utilizing Fura2-fluorescence. The measurements were made following depletion of intracellular Ca2+ stores by inhibition of the sarcoendoplasmic Ca2+ ATPase (SERCA) with thapsigargin in the absence of extracellular Ca2+, and the store-operated Ca2+ entry (SOCE) was estimated from the increase in [Ca2+]i following re-addition of extracellular Ca2+. As illustrated in Fig. 1, thapsigargin (1 µM) treatment in the absence of extracellular Ca2+ was followed by a transient increase in [Ca2+]i reflecting depletion of intracellular stores. The subsequent addition of extracellular Ca2+ was followed by a rapid increase in [Ca2+]i reflecting store operated Ca2+ entry (SOCE). The pretreatment with lithium was followed by a significant augmentation of the thapsigargin-induced increase in [Ca2+]i and of the increase in [Ca2+]i following re-addition of extracellular Ca2+ (Fig. 1).

Fig. 1

Thapsigargin-induced intracellular Ca2+ release and subsequent SOCE in UMR106 cells without and with pretreatment with lithium. A. Representative original tracings showing the intracellular Ca2+ concentration ([Ca2+]i) in Fura-2/AM loaded UMR106 cells prior to and following removal of extracellular Ca2+, addition of the sarco-endoplasmic Ca2+ ATPase (SERCA) inhibitor thapsigargin (1 µM) and re-addition of extracellular Ca2+ without (white circles) and with (black circles) prior lithium treatment (2 mM, 24 h). B,C. Arithmetic means ± SEM (n = 20-60) of the peak (left) and slope (right) values of [Ca2+]i increase following addition of thapsigargin reflecting Ca2+ release from intracellular stores (B) and of [Ca2+]i increase following re-addition of extracellular Ca2+ reflecting store-operated Ca2+ entry (C) in UMR cells incubated in the presence (black bars) and absence (white bars) of lithium (2 mM, 24 h) **(p<0.001), ***(p<0.001), unpaired Student's t-test.

Fig. 1

Thapsigargin-induced intracellular Ca2+ release and subsequent SOCE in UMR106 cells without and with pretreatment with lithium. A. Representative original tracings showing the intracellular Ca2+ concentration ([Ca2+]i) in Fura-2/AM loaded UMR106 cells prior to and following removal of extracellular Ca2+, addition of the sarco-endoplasmic Ca2+ ATPase (SERCA) inhibitor thapsigargin (1 µM) and re-addition of extracellular Ca2+ without (white circles) and with (black circles) prior lithium treatment (2 mM, 24 h). B,C. Arithmetic means ± SEM (n = 20-60) of the peak (left) and slope (right) values of [Ca2+]i increase following addition of thapsigargin reflecting Ca2+ release from intracellular stores (B) and of [Ca2+]i increase following re-addition of extracellular Ca2+ reflecting store-operated Ca2+ entry (C) in UMR cells incubated in the presence (black bars) and absence (white bars) of lithium (2 mM, 24 h) **(p<0.001), ***(p<0.001), unpaired Student's t-test.

Close modal

The additional treatment with Orai1 inhibitor 2-APB (50 µM) significantly blunted the thapsigargin-induced elevation of [Ca2+]i and virtually abrogated the increase in [Ca2+]i following re-addition of extracellular Ca2+ (Fig. 2).

Fig. 2

Effect of Orai1 inhibitor 2-APB on thapsigargin-induced intracellular Ca2+ release and subsequent SOCE in lithium treated UMR106 cells. A. Representative original tracings showing the intracellular Ca2+ concentration ([Ca2+]i) in Fura-2/AM loaded UMR106 cells prior to and following removal of extracellular Ca2+, addition of the sarco-endoplasmic Ca2+ ATPase (SERCA) inhibitor thapsigargin (1 µM) and re-addition of extracellular Ca2+ in control cells (white circles), and in lithium-pretreated cells without (black circles) or with (grey circles) simultaneous treatment with Orai inhibitor 2-APB (10 µM). B,C. Arithmetic means ± SEM (n = 22-60) of the peak (left) and slope (right) values of [Ca2+]i increase following addition of thapsigargin reflecting Ca2+ release from intracellular stores (B) and of [Ca2+]i increase following re-addition of extracellular Ca2+ reflecting store-operated Ca2+ entry (C) in untreated control cells (white bars) or in lithium pretreated (2 mM, 24 h) UMR106 cells in the absence (black bars) or presence (grey bars) of Orai inhibitor 2-APB (50 µM). **(p<0.001), ***(p<0.001), ANOVA.

Fig. 2

Effect of Orai1 inhibitor 2-APB on thapsigargin-induced intracellular Ca2+ release and subsequent SOCE in lithium treated UMR106 cells. A. Representative original tracings showing the intracellular Ca2+ concentration ([Ca2+]i) in Fura-2/AM loaded UMR106 cells prior to and following removal of extracellular Ca2+, addition of the sarco-endoplasmic Ca2+ ATPase (SERCA) inhibitor thapsigargin (1 µM) and re-addition of extracellular Ca2+ in control cells (white circles), and in lithium-pretreated cells without (black circles) or with (grey circles) simultaneous treatment with Orai inhibitor 2-APB (10 µM). B,C. Arithmetic means ± SEM (n = 22-60) of the peak (left) and slope (right) values of [Ca2+]i increase following addition of thapsigargin reflecting Ca2+ release from intracellular stores (B) and of [Ca2+]i increase following re-addition of extracellular Ca2+ reflecting store-operated Ca2+ entry (C) in untreated control cells (white bars) or in lithium pretreated (2 mM, 24 h) UMR106 cells in the absence (black bars) or presence (grey bars) of Orai inhibitor 2-APB (50 µM). **(p<0.001), ***(p<0.001), ANOVA.

Close modal

In order to test whether the effect of lithium on SOCE was mediated by NF-κB, experiments were repeated in the absence and presence of NF-κB inhibitor of wogonin (100 µM).

Again, SOCE was triggered in UMR106 cells by removal of extracellular Ca2+ and addition of the sarco-endoplasmic Ca2+ ATPase (SERCA) inhibitor thapsigargin (1 µM) followed by readdition of extracellular Ca2+. As illustrated in Fig. 3, SOCE was increased by treatment with lithium (2 mM, 24 h), an effect abrogated by wogonin (100 µM).

Fig. 3

Thapsigargin-induced intracellular Ca2+ release and subsequent SOCE in UMR106 cells without and with pretreatment with lithium in the absence or presence of wogonin. A. Representative original tracings showing the intracellular Ca2+ concentration ([Ca2+]i) in Fura-2/AM loaded UMR106 cells prior to and following removal of extracellular Ca2+, addition of the sarco-endoplasmic Ca2+ ATPase (SERCA) inhibitor thapsigargin (1 µM) and re-addition of extracellular Ca2+ in untreated control cells (white circles) or in cells pretreated with lithium (2 mM, 24 h) without (black circles) and with (grey circles) presence of wogonin (100 µM). B,C. Arithmetic means ± SEM (n = 23-46) of the peak (left) and slope (right) values of [Ca2+]i increase following addition of thapsigargin reflecting Ca2+ release from intracellular stores (B) and of [Ca2+]i increase following re-addition of extracellular Ca2+ reflecting store-operated Ca2+entry (C) in UMR cells incubated in the absence of lithium (white bars) and in the presence of lithium (2 mM, 24 hours) without (black bars) and with (grey bars) additional treatment with wogonin (100 µM). *(p<0.05),**(p<0.001), ***(p<0.001), ANOVA.

Fig. 3

Thapsigargin-induced intracellular Ca2+ release and subsequent SOCE in UMR106 cells without and with pretreatment with lithium in the absence or presence of wogonin. A. Representative original tracings showing the intracellular Ca2+ concentration ([Ca2+]i) in Fura-2/AM loaded UMR106 cells prior to and following removal of extracellular Ca2+, addition of the sarco-endoplasmic Ca2+ ATPase (SERCA) inhibitor thapsigargin (1 µM) and re-addition of extracellular Ca2+ in untreated control cells (white circles) or in cells pretreated with lithium (2 mM, 24 h) without (black circles) and with (grey circles) presence of wogonin (100 µM). B,C. Arithmetic means ± SEM (n = 23-46) of the peak (left) and slope (right) values of [Ca2+]i increase following addition of thapsigargin reflecting Ca2+ release from intracellular stores (B) and of [Ca2+]i increase following re-addition of extracellular Ca2+ reflecting store-operated Ca2+entry (C) in UMR cells incubated in the absence of lithium (white bars) and in the presence of lithium (2 mM, 24 hours) without (black bars) and with (grey bars) additional treatment with wogonin (100 µM). *(p<0.05),**(p<0.001), ***(p<0.001), ANOVA.

Close modal

In order to determine whether the lithium-induced increase in the cytosolic Ca2+ concentration could participate in the stimulation of FGF23 release, FGF23 transcript levels were determined by qRT-PCR. As illustrated in Fig. 4, lithium (2 mM) significantly increased FGF23 transcript levels in IPO cells (Fig. 4A) and UMR106 cells (Fig. 4B-C), an effect significantly blunted by Orai inhibitors 2-APB (50 µM) or YM58483 (100 nM).

Fig. 4

Effect of lithium on FGF23 transcript levels in IPO and UMR106 cells. A. Arithmetic means ± SEM (n = 12-17) of the FGF23 transcript levels in IPO cells without (white bar) and with (black bar) prior lithium treatment (2 mM). B. Arithmetic means ± SEM (n = 6) of the FGF23 transcript levels in UMR106 cells without (white bars) and with (black bars) prior lithium treatment (2 mM, 24 h) in the absence (left bars) and presence (right bars) of Orai inhibitor 2-APB (50 µM). C. Arithmetic means ± SEM (n = 16-18) of the FGF23 transcript levels in UMR106 cells without (white bars) and with (black bars) prior lithium treatment (2 mM, 24 h) in the absence (left bars) and presence (right bars) of Orai inhibitor YM58483 (100 nM). **, *** (p<0.01, p<0.001) indicates difference from control. ### (p<0.001) indicates difference from lithium alone.

Fig. 4

Effect of lithium on FGF23 transcript levels in IPO and UMR106 cells. A. Arithmetic means ± SEM (n = 12-17) of the FGF23 transcript levels in IPO cells without (white bar) and with (black bar) prior lithium treatment (2 mM). B. Arithmetic means ± SEM (n = 6) of the FGF23 transcript levels in UMR106 cells without (white bars) and with (black bars) prior lithium treatment (2 mM, 24 h) in the absence (left bars) and presence (right bars) of Orai inhibitor 2-APB (50 µM). C. Arithmetic means ± SEM (n = 16-18) of the FGF23 transcript levels in UMR106 cells without (white bars) and with (black bars) prior lithium treatment (2 mM, 24 h) in the absence (left bars) and presence (right bars) of Orai inhibitor YM58483 (100 nM). **, *** (p<0.01, p<0.001) indicates difference from control. ### (p<0.001) indicates difference from lithium alone.

Close modal

A further series of experiments explored whether lithium is effective through upregulation of the transcription factor NF-κB. To this end, the effect of lithium on the nuclear factor NF-κB subunit p65 transcript levels was tested. As illustrated in Fig. 5, lithium treatment indeed up-regulated the NF-κB p65 transcript levels in UMR106 cells (Fig. 5A). As illustrated in Fig. 5B, lithium treatment enhanced the nuclear localization of NF-κB p65.

Fig. 5

Effect of lithium on NF-κB p65 in UMR106 cells. A. Arithmetic means ± SEM (n = 6) of the NF-κB p65 transcript levels in UMR106 cells without (white bar) and with (black bar) prior lithium treatment (2 mM, 24 h). B. Confocal microscopy of NF-κB p65 abundance in UMR106 cells without (upper panels) and with (lower panels) prior lithium treatment (2 mM) (Nuclear Draq5, Red; NF-κB, Green), scale bar 20 µm. * (p<0.05), unpaired Student's t-test.

Fig. 5

Effect of lithium on NF-κB p65 in UMR106 cells. A. Arithmetic means ± SEM (n = 6) of the NF-κB p65 transcript levels in UMR106 cells without (white bar) and with (black bar) prior lithium treatment (2 mM, 24 h). B. Confocal microscopy of NF-κB p65 abundance in UMR106 cells without (upper panels) and with (lower panels) prior lithium treatment (2 mM) (Nuclear Draq5, Red; NF-κB, Green), scale bar 20 µm. * (p<0.05), unpaired Student's t-test.

Close modal

In order to test whether the effect of lithium on Orai1 transcript levels in UMR106 cells requires NF-κB, UMR106 cells were treated with lithium in the absence or presence of NF-κB inhibitors withaferin A or wogonin. As illustrated in Fig. 6, both inhibitors virtually abrogated the stimulating effect of lithium on Orai1 transcript levels in UMR106 cells.

Fig. 6

Effect of lithium on Orai1 transcript levels in UMR106 cells in the absence or presence of NF-κB inhibitors withaferin A or wogonin. A. Arithmetic means ± SEM (n = 6) of the Orai1 transcript levels in UMR106 cells without (white bars) and with (black bars) prior lithium treatment (2 mM, 24 h) in the absence (left bars) and presence (right bars) of NF-κB inhibitor withaferin A (500 nM). B. Arithmetic means ± SEM (n = 12-15) of the Orai1 transcript levels in UMR106 cells without (white bars) and with (black bars) prior lithium treatment (2 mM) in the absence (left bars) and presence (right bars) of NF-κB inhibitor wogonin (100 µM). **, *** (p<0.01, p<0.001) indicates difference from control. ### (p<0.001) indicates difference from lithium alone.

Fig. 6

Effect of lithium on Orai1 transcript levels in UMR106 cells in the absence or presence of NF-κB inhibitors withaferin A or wogonin. A. Arithmetic means ± SEM (n = 6) of the Orai1 transcript levels in UMR106 cells without (white bars) and with (black bars) prior lithium treatment (2 mM, 24 h) in the absence (left bars) and presence (right bars) of NF-κB inhibitor withaferin A (500 nM). B. Arithmetic means ± SEM (n = 12-15) of the Orai1 transcript levels in UMR106 cells without (white bars) and with (black bars) prior lithium treatment (2 mM) in the absence (left bars) and presence (right bars) of NF-κB inhibitor wogonin (100 µM). **, *** (p<0.01, p<0.001) indicates difference from control. ### (p<0.001) indicates difference from lithium alone.

Close modal

A final series of experiments tested whether the effect of lithium on FGF23 transcript levels in UMR106 cells was similarly dependent on NF-κB. To this end, FGF23 transcript levels were determined in UMR106 cells with or without NF-κB inhibitors withaferin or wogonin. As illustrated in Fig. 7, the stimulating effect of lithium on the FGF23 transcript levels in UMR106 cells was virtually abrogated by both, wogonin (100 µM) and withaferin A (500 nM).

Fig. 7

Effect of lithium on FGF23 transcript levels in UMR106 cells in the absence or presence of NF-κB inhibitors withaferin A or wogonin. A. Arithmetic means ± SEM (n = 12) of the FGF23 transcript levels in UMR106 cells without (white bars) and with (black bars) prior lithium treatment (2 mM, 24 h) in the absence (left bars) and presence (right bars) of NF-κB inhibitor withaferin A (500 nM). B. Arithmetic means ± SEM (n = 12) of the FGF23 transcript levels in UMR106 cells without (white bars) and with (black bars) prior lithium treatment (2 mM, 24 h) in the absence (left bars) and presence (right bars) of NF-κB inhibitor wogonin (100 µM). *** (p<0.001) indicates difference from control. ### (p<0.001) indicates difference from lithium alone.

Fig. 7

Effect of lithium on FGF23 transcript levels in UMR106 cells in the absence or presence of NF-κB inhibitors withaferin A or wogonin. A. Arithmetic means ± SEM (n = 12) of the FGF23 transcript levels in UMR106 cells without (white bars) and with (black bars) prior lithium treatment (2 mM, 24 h) in the absence (left bars) and presence (right bars) of NF-κB inhibitor withaferin A (500 nM). B. Arithmetic means ± SEM (n = 12) of the FGF23 transcript levels in UMR106 cells without (white bars) and with (black bars) prior lithium treatment (2 mM, 24 h) in the absence (left bars) and presence (right bars) of NF-κB inhibitor wogonin (100 µM). *** (p<0.001) indicates difference from control. ### (p<0.001) indicates difference from lithium alone.

Close modal

The present observations demonstrate that lithium up-regulates the Ca2+ channel Orai1 and enhances store operated Ca2+ entry (SOCE). Both effects are virtually abrogated by pharmacological inhibition of the transcription factor NF-κB. The present observations further reveal that lithium enhances NF-κB transcript levels. Lithium up-regulates FGF23 transcript levels, an effect virtually abrogated by pharmacological inhibition of Orai1 and NF-κB. Previous observations demonstrated the stimulation of Orai1 transcription and protein by NF-κB [61,62,63] and the stimulating effect of SOCE on FGF23 transcription and protein expression [64]. Effects of lithium on FGF23 release may in addition be modified by GSK3 phosphorylation [65], a known effect of lithium [66,67,68,69,70,71].

It is noteworthy, that the serum FGF23 level is elevated in gene targeted mice expressing WNK-resistant SPAK [72] or OSR1 [73]. Both SPAK and OSR1 stimulate renal tubular Na-Cl co-transporter, and lack of those kinases is expected to result in cell shrinkage, which fosters Ca2+ oscillations [74]. Orai1 is upregulated by the serum & glucocorticoid inducible kinase SGK1 [61,62,63,75], which is in turn markedly upregulated by cell shrinkage [76]. Orai1 is further regulated by the AMPK activated kinase [77]. Future studies will be required to explore whether this kinase participates in the regulation of FGF23 release.

FGF23 plasma concentrations are further enhanced in patients suffering from chronic kidney disease or injury [45,78,79,80,81,82,83,84,85,86,87,88,89]. Notably, plasma FGF23 levels increase prior to plasma phosphate concentrations and prior to the development of hyperparathyroidism [22,80,81,82,87]. FGF23 plasma levels are also elevated in diabetic nephropathy [90] and polycystic kidney disease [91,92,93]. Notably, in those diseases, FGF23 originates at least in part from formation in kidney. The signaling underlying the triggering of renal FGF23 formation in those diseases remains elusive [91,93]. It is tempting to speculate that deregulated intracellular Ca2+ signaling could contribute to the renal formation of FGF23. The hyperphosphatemia of renal insufficiency results in vascular calcification [94], which is counteracted by Klotho and FGF23 [95,96].

FGF23 downregulates 1α hydroxylase and thus the formation of 1,25(OH)2D3 [3,5], an effect requiring Klotho as a co-receptor [23,97]. Conversely, 1,25(OH)2D3 stimulates the release of FGF23 [98]. Lithium treatment increases FGF23 serum levels despite a decrease of 1,25(OH)2D3 serum concentrations [47], which is in turn expected to lower FGF23 release [99,100,101,102].

1,25(OH)2D3 stimulates both, renal and intestinal phosphate transport [13]. FGF23 reduces renal tubular phosphate reabsorption by decreasing 1,25(OH)2D3 formation and by more directly inhibiting Na+-coupled phosphate transport in proximal renal tubules [2,5]. FGF23 release is thus expected to trigger phosphaturia and decrease the serum phosphate concentration. As high serum phosphate concentrations foster vascular calcification and are associated with accelerated aging and decreased life span [103], an increased FGF23 release could counteract vascular calcification, aging and early death. Lithium has indeed been shown to attenuate tissue calcification [104]. Klotho [24] and FGF23 [25] are both powerful regulators of aging and lack of either, Klotho [24] or FGF23 [5] accelerates the development of several age-related disorders and leads to early death.

FGF23 is primarily produced in osteoblasts and its major biological and biomedical function is the regulation of 1,25(OH)2D3 formation [3,5]. The effect of lithium on FGF23 expression may thus be considered a side effect unrelated to the antidepressant activity of the drug [105]. The observed effect of lithium may, for instance, contribute to the known impact of lithium on inflammation [106]. However, 1,25(OH)2D3 has been shown to be a powerful regulator of mood [107,108,109] and the influence on FGF23 may indirectly modify the neurobiological effects of lithium. Moreover, NF-κB [110,111] and Orai1[112,113,114] are expressed in the brain and it is tempting to speculate that the effect of lithium on NF-κB and Orai1 may contribute to the neuronal effects of this widely used drug. Moreover, SOCE contributes to the regulation of function and to the pathophysiology of neurons [115] and glial cells [114,115,116]. Known neurobiological and neuro-psychiatric effects of lithium include not only antidepressant activity but as well neuroprotection against several neurotoxic paradigms including Alzheimer disease [117]. Notably, Orai1 has been shown to confer survival of several cell types [118,119,120,121,122]. To the best of our knowledge, an effect of lithium on Orai1 expression and function has never been shown. In view of the present observations, extensive additional experimentation is warranted clarifying the neurobiological significance of lithium sensitive up-regulation of NF-κB, Orai1, FGF23 and/or related growth factors.

In conclusion, the present observations reveal that an increase in the cytosolic Ca2+ concentration stimulates the expression of FGF23 in UMR106 osteoblast cells. Lithium upregulates cytosolic Ca2+ release and subsequent store-operated Ca2+ entry, which are mainly accomplished by Orai1 and its regulator STIM1.

The authors acknowledge the technical assistance of E. Faber and the meticulous preparation of the manuscript by L. Subasic. The study was supported by the Deutsche Forschungsgemeinschaft (La 315/15-1 and Fo 695/1-1 and Fo 695/2-1).

All authors disclose that they have not any potential conflict of interest (e.g., consultancies, stock ownership, equity interests, patent-licensing arrangements, lack of access to data, or lack of control of the decision to publish).

1.
Hori M, Shimizu Y, Fukumoto S: Minireview: fibroblast growth factor 23 in phosphate homeostasis and bone metabolism. Endocrinology 2011;152:4-10.
2.
Marsell R, Jonsson KB: The phosphate regulating hormone fibroblast growth factor-23. Acta Physiol (Oxf) 2010;200:97-106.
3.
Gattineni J, Twombley K, Goetz R, Mohammadi M, Baum M: Regulation of Serum 1,25(OH)2Vitamin D3 levels by Fibroblast Growth Factor 23 is Mediated by FGF Receptors 3 and 4. Am J Physiol Renal Physiol 2011;301:F371-F377.
4.
Shimada T, Kakitani M, Yamazaki Y, Hasegawa H, Takeuchi Y, Fujita T, Fukumoto S, Tomizuka K, Yamashita T: Targeted ablation of Fgf23 demonstrates an essential physiological role of FGF23 in phosphate and vitamin D metabolism. J Clin. Invest 2004;113:561-568.
5.
Shimada T, Yamazaki Y, Takahashi M, Hasegawa H, Urakawa I, Oshima T, Ono K, Kakitani M, Tomizuka K, Fujita T, Fukumoto S, Yamashita T: Vitamin D receptor-independent FGF23 actions in regulating phosphate and vitamin D metabolism. Am. J Physiol Renal Physiol 2005;289:F1088-F1095.
6.
Inoue Y, Segawa H, Kaneko I, Yamanaka S, Kusano K, Kawakami E, Furutani J, Ito M, Kuwahata M, Saito H, Fukushima N, Kato S, Kanayama HO, Miyamoto K: Role of the vitamin D receptor in FGF23 action on phosphate metabolism. Biochem. J 2005;390:325-331.
7.
Bai X, Miao D, Li J, Goltzman D, Karaplis AC: Transgenic mice overexpressing human fibroblast growth factor 23 (R176Q) delineate a putative role for parathyroid hormone in renal phosphate wasting disorders. Endocrinology 2004;145:5269-5279.
8.
Bai XY, Miao D, Goltzman D, Karaplis AC: The autosomal dominant hypophosphatemic rickets R176Q mutation in fibroblast growth factor 23 resists proteolytic cleavage and enhances in vivo biological potency. J Biol. Chem. 2003;278:9843-9849.
9.
Saito H, Kusano K, Kinosaki M, Ito H, Hirata M, Segawa H, Miyamoto K, Fukushima N: Human fibroblast growth factor-23 mutants suppress Na+-dependent phosphate co-transport activity and 1alpha,25-dihydroxyvitamin D3 production. J Biol. Chem. 2003;278:2206-2211.
10.
Segawa H, Kawakami E, Kaneko I, Kuwahata M, Ito M, Kusano K, Saito H, Fukushima N, Miyamoto K: Effect of hydrolysis-resistant FGF23-R179Q on dietary phosphate regulation of the renal type-II Na/Pi transporter. Pflugers Arch. 2003;446:585-592.
11.
Shimada T, Mizutani S, Muto T, Yoneya T, Hino R, Takeda S, Takeuchi Y, Fujita T, Fukumoto S, Yamashita T: Cloning and characterization of FGF23 as a causative factor of tumor-induced osteomalacia. Proc. Natl. Acad. Sci. U.S.A 2001;98:6500-6505.
12.
Shimada T, Hasegawa H, Yamazaki Y, Muto T, Hino R, Takeuchi Y, Fujita T, Nakahara K, Fukumoto S, Yamashita T: FGF-23 is a potent regulator of vitamin D metabolism and phosphate homeostasis. J Bone Miner. Res. 2004;19:429-435.
13.
Brown AJ, Finch J, Slatopolsky E: Differential effects of 19-nor-1,25-dihydroxyvitamin D(2) and 1,25-dihydroxyvitamin D(3) on intestinal calcium and phosphate transport. J Lab Clin. Med. 2002;139:279-284.
14.
Miyamoto K, Segawa H, Ito M, Kuwahata M: Physiological regulation of renal sodium-dependent phosphate cotransporters. Jpn J Physiol 2004;54:93-102.
15.
Murer H, Hernando N, Forster I, Biber J: Proximal tubular phosphate reabsorption: molecular mechanisms. Physiol Rev. 2000;80:1373-1409.
16.
Segawa H, Kaneko I, Yamanaka S, Ito M, Kuwahata M, Inoue Y, Kato S, Miyamoto K: Intestinal Na-P(i) cotransporter adaptation to dietary P(i) content in vitamin D receptor null mice. Am. J Physiol Renal Physiol 2004;287:F39-F47.
17.
Larsson T, Marsell R, Schipani E, Ohlsson C, Ljunggren O, Tenenhouse HS, Juppner H, Jonsson KB: Transgenic mice expressing fibroblast growth factor 23 under the control of the a1(I) collagen promoter exhibit growth retardation, osteomalacia and distrubed phosphate homeostatis. Endocrinology 2003;145:3094.
18.
Desjardins L, Liabeuf S, Renard C, Lenglet A, Lemke HD, Choukroun G, Drueke TB, Massy ZA, Group. EUTEW: FGF23 is independently associated with vascular calcification but not bone mineral density in patients at various CKD stages. Osteoporos. Int 2012;23:2017-2025.
19.
Mackenzie NC, MacRae VE: The role of cellular senescence during vascular calcification: a key paradigm in aging research. Curr. Aging Sci 2011;4:128-136.
20.
Schoppet M, Hofbauer LC, Brinskelle-Schmal N, Varennes A, Goudable J, Richard M, Hawa G, Chapurlat R, Szulc P: Serum Level of the Phosphaturic Factor FGF23 Is Associated with Abdominal Aortic Calcification in Men: The STRAMBO Study. J Clin Endocrinol. Metab 2012;97:E575-E583.
21.
Sitara D, Razzaque MS, Hesse M, Yoganathan S, Taguchi T, Erben RG, Juppner H, Lanske B: Homozygous ablation of fibroblast growth factor-23 results in hyperphosphatemia and impaired skeletogenesis, and reverses hypophosphatemia in Phex-deficient mice. Matrix Biol 2004;23:421-432.
22.
Hu MC, Shiizaki K, Kuro O, Moe OW: Fibroblast growth factor 23 and klotho: physiology and pathophysiology of an endocrine network of mineral metabolism. Annu. Rev. Physiol 2013;75:503-533.
23.
Kuro-o M: Overview of the FGF23-Klotho axis. Pediatr. Nephrol 2010;25:583-590.
24.
Kuro-o M: Klotho. Pflugers Arch. 2010;459:333-343.
25.
Bernheim J, Benchetrit S: The potential roles of FGF23 and Klotho in the prognosis of renal and cardiovascular diseases. Nephrol. Dial. Transplant. 2011;26:2433-2438.
26.
Carpinelli MR, Wise AK, Burt RA: Vitamin D-deficient diet rescues hearing loss in Klotho mice. Hear. Res 2011;275:105-109.
27.
Fukuchi Y: The aging lung and chronic obstructive pulmonary disease: similarity and difference. Proc Am Thorac. Soc 2009;6:570-572.
28.
Kempe DS, Ackermann TF, Fischer SS, Koka S, Boini KM, Mahmud H, Foller M, Rosenblatt KP, Kuro O, Lang F: Accelerated suicidal erythrocyte death in Klotho-deficient mice. Pflugers Arch 2009;458:503-512.
29.
Kosakai A, Ito D, Nihei Y, Yamashita S, Okada Y, Takahashi K, Suzuki N: Degeneration of mesencephalic dopaminergic neurons in klotho mouse related to vitamin D exposure. Brain Res 2011;1382:109-117.
30.
Kuro-o M, Matsumura Y, Aizawa H, Kawaguchi H, Suga T, Utsugi T, Ohyama Y, Kurabayashi M, Kaname T, Kume E, Iwasaki H, Iida A, Shiraki-Iida T, Nishikawa S, Nagai R, Nabeshima YI: Mutation of the mouse klotho gene leads to a syndrome resembling ageing. Nature 1997;390:45-51.
31.
Kuro O: Klotho and betaKlotho. Adv. Exp Med Biol 2012;728:25-40.
32.
Maltese G, Karalliedde J: The putative role of the antiageing protein klotho in cardiovascular and renal disease. Int J Hypertens. 2012;2012:757469.
33.
Nikolov IG, Mozar A, Drueke TB, Massy ZA: Impact of disturbances of calcium and phosphate metabolism on vascular calcification and clinical outcomes in patients with chronic kidney disease. Blood Purif. 2009;27:350-359.
34.
Ohnishi M, Razzaque MS: Dietary and genetic evidence for phosphate toxicity accelerating mammalian aging. FASEB J 2010;24:3562-3571.
35.
Saito Y, Nakamura T, Ohyama Y, Suzuki T, Iida A, Shiraki-Iida T, M K-o, Nabeshima Y, Kurabayashi M, Nagai R: In vivo klotho gene delivery protects against endothelial dysfunction in multiple risk factor syndrome. Biochem Biophys. Res Commun. 2000;276:767-772.
36.
Shimada T, Takeshita Y, Murohara T, Sasaki K, Egami K, Shintani S, Katsuda Y, Ikeda H, Nabeshima Y, Imaizumi T: Angiogenesis and vasculogenesis are impaired in the precocious-aging klotho mouse. Circulation 2004;110:1148-1155.
37.
Takeshita K, Fujimori T, Kurotaki Y, Honjo H, Tsujikawa H, Yasui K, Lee JK, Kamiya K, Kitaichi K, Yamamoto K, Ito M, Kondo T, Iino S, Inden Y, Hirai M, Murohara T, Kodama I, Nabeshima Y: Sinoatrial node dysfunction and early unexpected death of mice with a defect of klotho gene expression. Circulation 2004;109:1776-1782.
38.
Torres PU, Prie D, Molina-Bletry V, Beck L, Silve C, Friedlander G: Klotho: an antiaging protein involved in mineral and vitamin D metabolism. Kidney Int 2007;71:730-737.
39.
Tuohimaa P: Vitamin D and aging. J Steroid Biochem Mol Biol 2009;114:78-84.
40.
Yoshida T, Fujimori T, Nabeshima Y: Mediation of unusually high concentrations of 1,25-dihydroxyvitamin D in homozygous klotho mutant mice by increased expression of renal 1alpha-hydroxylase gene. Endocrinology 2002;143:683-689.
41.
Dermaku-Sopjani M, Sopjani M, Saxena A, Shojaiefard M, Bogatikov E, Alesutan I, Eichenmuller M, Lang F: Downregulation of NaPi-IIa and NaPi-IIb Na-coupled phosphate transporters by coexpression of Klotho. Cell Physiol Biochem 2011;28:251-258.
42.
Hu MC, Shi M, Zhang J, Pastor J, Nakatani T, Lanske B, Razzaque MS, Rosenblatt KP, Baum MG, M K-o, Moe OW: Klotho: a novel phosphaturic substance acting as an autocrine enzyme in the renal proximal tubule. FASEB J 2010;24:3438-3450.
43.
Giachelli CM: Vascular calcification: in vitro evidence for the role of inorganic phosphate. J. Am. Soc. Nephrol. 2003;14:S300-S304.
44.
Tonelli M, Sacks F, Pfeffer M, Gao Z, Curhan G: Relation between serum phosphate level and cardiovascular event rate in people with coronary disease. Circulation 2005;112:2627-2633.
45.
Hu MC, Shiizaki K, Kuro-o M, Moe OW: Fibroblast growth factor 23 and Klotho: physiology and pathophysiology of an endocrine network of mineral metabolism. Annu Rev Physiol 2013;75:503-533.
46.
Masuyama R, Stockmans I, Torrekens S, Van Looveren R, Maes C, Carmeliet P, Bouillon R, Carmeliet G: Vitamin D receptor in chondrocytes promotes osteoclastogenesis and regulates FGF23 production in osteoblasts. J Clin Invest 2006;116:3150-3159.
47.
Fakhri H, Pathare G, Fajol A, Zhang B, Bock T, Kandolf R, Schleicher E, Biber J, Foller M, Lang UE, Lang F: Regulation of mineral metabolism by lithium. Pflugers Arch 2013;10.1007/s00424-013-1340-y.
48.
Eldar-Finkelman H: Glycogen synthase kinase 3: an emerging therapeutic target. Trends Mol. Med. 2002;8:126-132.
49.
Kakefuda K, Oyagi A, Ishisaka M, Tsuruma K, Shimazawa M, Yokota K, Shirai Y, Horie K, Saito N, Takeda J, Hara H: Diacylglycerol kinase beta knockout mice exhibit lithium-sensitive behavioral abnormalities. PLoS. One. 2010;5:e13447.
50.
Martinez A, Castro A, Dorronsoro I, Alonso M: Glycogen synthase kinase 3 (GSK-3) inhibitors as new promising drugs for diabetes, neurodegeneration, cancer, and inflammation. Med. Res. Rev. 2002;22:373-384.
51.
Ritter M, Dartsch P, Waldegger S, Haller T, Zwierzina H, Lang HJ, Lang F: Effects of bradykinin on NIH 3T3 fibroblasts pretreated with lithium. Mimicking events of Ha-ras oncogene expression. Biochim Biophys Acta 1997;1358:23-30.
52.
Parekh AB: Store-operated CRAC channels: function in health and disease. Nat Rev Drug Discov 2010;9:399-410.
53.
Prakriya M, Feske S, Gwack Y, Srikanth S, Rao A, Hogan PG: Orai1 is an essential pore subunit of the CRAC channel. Nature 2006;443:230-233.
54.
Vig M, Peinelt C, Beck A, Koomoa DL, Rabah D, Koblan-Huberson M, Kraft S, Turner H, Fleig A, Penner R, Kinet JP: CRACM1 is a plasma membrane protein essential for store-operated Ca2+ entry. Science 2006;312:1220-1223.
55.
Zhang SL, Kozak JA, Jiang W, Yeromin AV, Chen J, Yu Y, Penna A, Shen W, Chi V, Cahalan MD: Store-dependent and -independent modes regulating Ca2+ release-activated Ca2+ channel activity of human Orai1 and Orai3. J Biol Chem 2008;283:17662-17671.
56.
Fahrner M, Muik M, Derler I, Schindl R, Fritsch R, Frischauf I, Romanin C: Mechanistic view on domains mediating STIM1-Orai coupling. Immunol Rev 2009;231:99-112.
57.
Peinelt C, Vig M, Koomoa DL, Beck A, Nadler MJ, Koblan-Huberson M, Lis A, Fleig A, Penner R, Kinet JP: Amplification of CRAC current by STIM1 and CRACM1 (Orai1). Nat Cell Biol 2006;8:771-773.
58.
Penna A, Demuro A, Yeromin AV, Zhang SL, Safrina O, Parker I, Cahalan MD: The CRAC channel consists of a tetramer formed by Stim-induced dimerization of Orai dimers. Nature 2008;456:116-120.
59.
Saini RK, Kaneko I, Jurutka PW, Forster R, Hsieh A, Hsieh JC, Haussler MR, Whitfield GK: 1,25-dihydroxyvitamin D(3) regulation of fibroblast growth factor-23 expression in bone cells: evidence for primary and secondary mechanisms modulated by leptin and interleukin-6. Calcif Tissue Int 2013;92:339-353.
60.
Alexander D, Biller R, Rieger M, Ardjomandi N, Reinert S: Phenotypic characterization of a human immortalized cranial periosteal cell line. Cell Physiol Biochem 2015;35:2244-2254.
61.
Eylenstein A, Gehring EM, Heise N, Shumilina E, Schmidt S, Szteyn K, Munzer P, Nurbaeva MK, Eichenmuller M, Tyan L, Regel I, Foller M, Kuhl D, Soboloff J, Penner R, Lang F: Stimulation of Ca2+-channel Orai1/STIM1 by serum- and glucocorticoid-inducible kinase 1 (SGK1). FASEB J 2011;25:2012-2021.
62.
Eylenstein A, Schmidt S, Gu S, Yang W, Schmid E, Schmidt EM, Alesutan I, Szteyn K, Regel I, Shumilina E, Lang F: Transcription factor NF-kappaB regulates expression of pore-forming Ca2+ channel unit, Orai1, and its activator, STIM1, to control Ca2+ entry and affect cellular functions. J Biol Chem 2012;287:2719-2730.
63.
Lang F, Shumilina E: Regulation of ion channels by the serum- and glucocorticoid-inducible kinase SGK1. FASEB J 2013;27:3-12.
64.
Zhang B, Yan J, Umbach AT, Fakhri H, Fajol A, Schmidt S, Salker MS, Chen H, Alexander D, Spichtig D, Daryadel A, Wagner CA, Föller M, Lang, F: NFκB-sensitive Orai1 expression in the regulation of FGF23 release. J Mol Med 2015; in press.
65.
Fajol A, Chen H, Umbach AT, Quarles LD, Lang F, Foller M: Enhanced FGF23 production in mice expressing PI3K-insensitive GSK3 is normalized by beta-blocker treatment. FASEB J 2015;10.1096/fj.15-279943.
66.
Bhat RV, Budd Haeberlein SL, Avila J: Glycogen synthase kinase 3: a drug target for CNS therapies. J Neurochem. 2004;89:1313-1317.
67.
Hernandez F, Lucas JJ, Avila J: GSK3 and tau: two convergence points in Alzheimer's disease. J Alzheimers. Dis. 2013;33 Suppl 1:S141-S144.
68.
Jope RS: Glycogen synthase kinase-3 in the etiology and treatment of mood disorders. Front Mol. Neurosci. 2011;4:16.
69.
Rao R: Glycogen synthase kinase-3 regulation of urinary concentrating ability. Curr. Opin. Nephrol. Hypertens. 2012;21:541-546.
70.
Kjaersgaard G, Madsen K, Marcussen N, Christensen S, Walter S, Jensen BL: Tissue injury after lithium treatment in human and rat postnatal kidney involves glycogen synthase kinase-3beta-positive epithelium. Am. J Physiol Renal Physiol 2012;302:F455-F465.
71.
George B, Vollenbroker B, Saleem MA, Huber TB, Pavenstadt H, Weide T: GSK3beta inactivation in podocytes results in decreased phosphorylation of p70S6K accompanied by cytoskeletal rearrangements and inhibited motility. Am J Physiol Renal Physiol 2011;300:F1152-F1162.
72.
Pathare G, Foller M, Michael D, Walker B, Hierlmeier M, Mannheim JG, Pichler BJ, Lang F: Enhanced FGF23 Serum Concentrations and Phosphaturia in Gene Targeted Mice Expressing WNK-Resistant Spak. Kidney Blood Press Res. 2012;36:355-364.
73.
Pathare G, Foller M, Daryadel A, Mutig K, Bogatikov E, Fajol A, Almilaji A, Michael D, Stange G, Voelkl J, Wagner CA, Bachmann S, Lang F: OSR1-Sensitive Renal Tubular Phosphate Reabsorption. Kidney Blood Press Res. 2012;36:149-161.
74.
Ritter M, Woll E, Waldegger S, Haussinger D, Lang HJ, Scholz W, Scholkens B, Lang F: Cell shrinkage stimulates bradykinin-induced cell membrane potential oscillations in NIH 3T3 fibroblasts expressing the ras-oncogene. Pflugers Arch 1993;423:221-224.
75.
Borst O, Schmidt EM, Munzer P, Schonberger T, Towhid ST, Elvers M, Leibrock C, Schmid E, Eylenstein A, Kuhl D, May AE, Gawaz M, Lang F: The serum- and glucocorticoid-inducible kinase 1 (SGK1) influences platelet calcium signaling and function by regulation of Orai1 expression in megakaryocytes. Blood 2012;119:251-261.
76.
Lang F, Bohmer C, Palmada M, Seebohm G, Strutz-Seebohm N, Vallon V: (Patho)physiological significance of the serum- and glucocorticoid-inducible kinase isoforms. Physiol Rev. 2006;86:1151-1178.
77.
Bhavsar SK, Schmidt S, Bobbala D, Nurbaeva MK, Hosseinzadeh Z, Merches K, Fajol A, Wilmes J, Lang F: AMPKalpha1-sensitivity of Orai1 and Ca(2+) entry in T - lymphocytes. Cell Physiol Biochem 2013;32:687-698.
78.
Unsal A, Kose BS, Koc Y, Basturk T, Sakaci T, Ahbap E, Sinangil A: Relationship of Fibroblast Growth Factor 23 with Left Ventricle Mass Index and Coronary Calcificaton in Chronic Renal Disease. Kidney Blood Press Res. 2012;36:55-64.
79.
Komaba H, Fukagawa M: The role of FGF23 in CKD-with or without Klotho. Nat. Rev. Nephrol. 2012;8:484-490.
80.
Liu S, Guo R, Simpson LG, Xiao ZS, Burnham CE, Quarles LD: Regulation of fibroblastic growth factor 23 expression but not degradation by PHEX. J Biol Chem 2003;278:37419-37426.
81.
Lu Y, Feng JQ: FGF23 in skeletal modeling and remodeling. Curr. Osteoporos. Rep. 2011;9:103-108.
82.
Yamashita T, Yoshioka M, Itoh N: Identification of a novel fibroblast growth factor, FGF-23, preferentially expressed in the ventrolateral thalamic nucleus of the brain. Biochem Biophys Res Commun 2000;277:494-498.
83.
Evenepoel P, Meijers B, Viaene L, Bammens B, Claes K, Kuypers D, Vanderschueren D, Vanrenterghem Y: Fibroblast growth factor-23 in early chronic kidney disease: additional support in favor of a phosphate-centric paradigm for the pathogenesis of secondary hyperparathyroidism. Clin J Am Soc Nephrol 2010;5:1268-1276.
84.
Gutierrez O, Isakova T, Rhee E, Shah A, Holmes J, Collerone G, Juppner H, Wolf M: Fibroblast growth factor-23 mitigates hyperphosphatemia but accentuates calcitriol deficiency in chronic kidney disease. J Am Soc Nephrol 2005;16:2205-2215.
85.
Massy ZA, Drueke TB: Vascular calcification. Curr Opin Nephrol Hypertens 2013;22:405-412.
86.
Shigematsu T, Kazama JJ, Yamashita T, Fukumoto S, Hosoya T, Gejyo F, Fukagawa M: Possible involvement of circulating fibroblast growth factor 23 in the development of secondary hyperparathyroidism associated with renal insufficiency. Am J Kidney Dis 2004;44:250-256.
87.
Isakova T, Wahl P, Vargas GS, Gutierrez OM, Scialla J, Xie H, Appleby D, Nessel L, Bellovich K, Chen J, Hamm L, Gadegbeku C, Horwitz E, Townsend RR, Anderson CA, Lash JP, Hsu CY, Leonard MB, Wolf M: Fibroblast growth factor 23 is elevated before parathyroid hormone and phosphate in chronic kidney disease. Kidney Int 2011;79:1370-1378.
88.
Artunc F, Nowak A, Muller C, Peter A, Heyne N, Haring HU, Friedrich B: Mortality prediction using modern peptide biomarkers in hemodialysis patients-a comparative analysis. Kidney Blood Press Res 2014;39:563-572.
89.
Feger M, Mia S, Pakladok T, Nicolay JP, Alesutan I, Schneider SW, Voelkl J, Lang F: Down-regulation of renal klotho expression by Shiga toxin 2. Kidney Blood Press Res 2014;39:441-449.
90.
Zanchi C, Locatelli M, Benigni A, Corna D, Tomasoni S, Rottoli D, Gaspari F, Remuzzi G, Zoja C: Renal expression of FGF23 in progressive renal disease of diabetes and the effect of ace inhibitor. PLoS One 2013;8:e70775.
91.
Lang F, Foller M: Renal FGF23 formation in polycystic kidney disease. Kidney International 2013;in press:
92.
Pavik I, Jaeger P, Kistler AD, Poster D, Krauer F, Cavelti-Weder C, Rentsch KM, Wuthrich RP, Serra AL: Patients with autosomal dominant polycystic kidney disease have elevated fibroblast growth factor 23 levels and a renal leak of phosphate. Kidney Int 2011;79:234-240.
93.
Spichtig D, Zhang H, Mohebbi N, Pavik I, Petzold K, Stange G, Saleh L, Edenhofer I, Segerer S, Biber J, Jaeger P, Serra AL, Wagner CA: Renal Expression of FGF23 and Peripheral Resistance to 1 elevated FGF23 in 2 Rodent Models of Polycystic Kidney Disease. Kidney Interational 2013;in press:
94.
London GM, Guerin AP, Marchais SJ, Metivier F, Pannier B, Adda H: Arterial media calcification in end-stage renal disease: impact on all-cause and cardiovascular mortality. Nephrol. Dial. Transplant. 2003;18:1731-1740.
95.
Lang F, Ritz E, Voelkl J, Alesutan I: Vascular calcification-is aldosterone a culprit? Nephrol. Dial. Transplant. 2013;28:1080-1084.
96.
Lim K, Lu TS, Molostvov G, Lee C, Lam FT, Zehnder D, Hsiao LL: Vascular Klotho deficiency potentiates the development of human artery calcification and mediates resistance to fibroblast growth factor 23. Circulation 2012;125:2243-2255.
97.
Bai X, Dinghong Q, Miao D, Goltzman D, Karaplis AC: Klotho ablation converts the biochemical and skeletal alterations in FGF23 (R176Q) transgenic mice to a Klotho-deficient phenotype. Am J Physiol Endocrinol Metab 2009;296:E79-E88.
98.
Masuyama R, Stockmans I, Torrekens S, Van Looveren R, Maes C, Carmeliet P, Bouillon R, Carmeliet G: Vitamin D receptor in chondrocytes promotes osteoclastogenesis and regulates FGF23 production in osteoblasts. J Clin. Invest 2006;116:3150-3159.
99.
Cross HR, Radda GK, Clarke K: The role of Na+/K+ ATPase activity during low flow ischemia in preventing myocardial injury: a 31P, 23Na and 87Rb NMR spectroscopic study. Magn Reson. Med 1995;34:673-685.
100.
Sakoda H, Gotoh Y, Katagiri H, Kurokawa M, Ono H, Onishi Y, Anai M, Ogihara T, Fujishiro M, Fukushima Y, Abe M, Shojima N, Kikuchi M, Oka Y, Hirai H, Asano T: Differing roles of Akt and serum- and glucocorticoid-regulated kinase in glucose metabolism, DNA synthesis, and oncogenic activity. J Biol Chem. 2003;278:25802-25807.
101.
Shaw M, Cohen P, Alessi DR: Further evidence that the inhibition of glycogen synthase kinase-3beta by IGF-1 is mediated by PDK1/PKB-induced phosphorylation of Ser-9 and not by dephosphorylation of Tyr-216. FEBS Lett. 1997;416:307-311.
102.
Wyatt AW, Hussain A, Amann K, Klingel K, Kandolf R, Artunc F, Grahammer F, Huang DY, Vallon V, Kuhl D, Lang F: DOCA-induced phosphorylation of glycogen synthase kinase 3beta. Cell Physiol Biochem. 2006;17:137-144.
103.
Rodriguez M, Martinez-Moreno JM, Rodriguez-Ortiz ME, Munoz-Castaneda JR, Almaden Y: Vitamin D and vascular calcification in chronic kidney disease. Kidney Blood Press Res. 2011;34:261-268.
104.
Tyber MA: Treatment of the painful shoulder syndrome with amitriptyline and lithium carbonate. Can Med Assoc J 1974;111:137-140.
105.
Bschor T: Lithium in the treatment of major depressive disorder. Drugs 2014;74:855-862.
106.
Nassar A, Azab AN: Effects of lithium on inflammation. ACS Chem Neurosci 2014;5:451-458.
107.
Glocke M, Lang F, Schaeffeler E, Lang T, Schwab M, Lang UE: Impact of vitamin D receptor VDR rs2228570 polymorphism in oldest old. Kidney Blood Press Res 2013;37:311-322.
108.
Lang UE, Beglinger C, Schweinfurth N, Walter M, Borgwardt S: Nutritional Aspects of Depression. Cell Physiol Biochem 2015;37:1029-1043.
109.
Ubbenhorst A, Striebich S, Lang F, Lang UE: Exploring the relationship between vitamin D and basic personality traits. Psychopharmacology (Berl) 2011;215:733-737.
110.
O'Neill LA, Kaltschmidt C: NF-kappa B: a crucial transcription factor for glial and neuronal cell function. Trends Neurosci 1997;20:252-258.
111.
Salles A, Romano A, Freudenthal R: Synaptic NF-kappa B pathway in neuronal plasticity and memory. J Physiol Paris 2014;108:256-262.
112.
Gruszczynska-Biegala J, Kuznicki J: Native STIM2 and ORAI1 proteins form a calcium-sensitive and thapsigargin-insensitive complex in cortical neurons. J Neurochem 2013;126:727-738.
113.
Klejman ME, Gruszczynska-Biegala J, Skibinska-Kijek A, Wisniewska MB, Misztal K, Blazejczyk M, Bojarski L, Kuznicki J: Expression of STIM1 in brain and puncta-like co-localization of STIM1 and ORAI1 upon depletion of Ca(2+) store in neurons. Neurochem Int 2009;54:49-55.
114.
Michaelis M, Nieswandt B, Stegner D, Eilers J, Kraft R: STIM1, STIM2, and Orai1 regulate store-operated calcium entry and purinergic activation of microglia. Glia 2015;63:652-663.
115.
Kraft R: STIM and ORAI proteins in the nervous system. Channels (Austin) 2015;9:245-252.
116.
Liang C, Du T, Zhou J, Verkhratsky A, Peng L: Ammonium increases Ca(2+) signalling and up-regulates expression of TRPC1 gene in astrocytes in primary cultures and in the in vivo brain. Neurochem Res 2014;39:2127-2135.
117.
Camins A, Verdaguer E, Junyent F, Yeste-Velasco M, Pelegri C, Vilaplana J, Pallas M: Potential mechanisms involved in the prevention of neurodegenerative diseases by lithium. CNS Neurosci Ther 2009;15:333-344.
118.
Kondratska K, Kondratskyi A, Yassine M, Lemonnier L, Lepage G, Morabito A, Skryma R, Prevarskaya N: Orai1 and STIM1 mediate SOCE and contribute to apoptotic resistance of pancreatic adenocarcinoma. Biochim Biophys Acta 2014;1843:2263-2269.
119.
Liu H, Hughes JD, Rollins S, Chen B, Perkins E: Calcium entry via ORAI1 regulates glioblastoma cell proliferation and apoptosis. Exp Mol Pathol 2011;91:753-760.
120.
Raphael M, Lehen'kyi V, Vandenberghe M, Beck B, Khalimonchyk S, Vanden Abeele F, Farsetti L, Germain E, Bokhobza A, Mihalache A, Gosset P, Romanin C, Clezardin P, Skryma R, Prevarskaya N: TRPV6 calcium channel translocates to the plasma membrane via Orai1-mediated mechanism and controls cancer cell survival. Proc Natl Acad Sci U S A 2014;111:E3870-3879.
121.
Schmidt S, Liu G, Liu G, Yang W, Honisch S, Pantelakos S, Stournaras C, Honig A, Lang F: Enhanced Orai1 and STIM1 expression as well as store operated Ca2+ entry in therapy resistant ovary carcinoma cells. Oncotarget 2014;5:4799-4810.
122.
Zhu H, Zhang H, Jin F, Fang M, Huang M, Yang CS, Chen T, Fu L, Pan Z: Elevated Orai1 expression mediates tumor-promoting intracellular Ca2+ oscillations in human esophageal squamous cell carcinoma. Oncotarget 2014;5:3455-3471.
Open Access License / Drug Dosage / Disclaimer
This article is licensed under the Creative Commons Attribution-NonCommercial-NoDerivatives 4.0 International License (CC BY-NC-ND). Usage and distribution for commercial purposes as well as any distribution of modified material requires written permission. Drug Dosage: The authors and the publisher have exerted every effort to ensure that drug selection and dosage set forth in this text are in accord with current recommendations and practice at the time of publication. However, in view of ongoing research, changes in government regulations, and the constant flow of information relating to drug therapy and drug reactions, the reader is urged to check the package insert for each drug for any changes in indications and dosage and for added warnings and precautions. This is particularly important when the recommended agent is a new and/or infrequently employed drug. Disclaimer: The statements, opinions and data contained in this publication are solely those of the individual authors and contributors and not of the publishers and the editor(s). The appearance of advertisements or/and product references in the publication is not a warranty, endorsement, or approval of the products or services advertised or of their effectiveness, quality or safety. The publisher and the editor(s) disclaim responsibility for any injury to persons or property resulting from any ideas, methods, instructions or products referred to in the content or advertisements.