Background: Little is known about the effect of salt content of ingested fluid on intestinal transport processes. Osmosensitive genes include the serum- and glucocorticoid-inducible kinase SGK1, which is up-regulated by hyperosmolarity and cell shrinkage. SGK1 is in turn a powerful stimulator of the intestinal Na+/H+ exchanger NHE3. The present study was thus performed to elucidate, whether the NaCl content of beverages influences NHE3 activity. Methods: Mice were offered access to either plain water or isotonic saline ad libitum. NHE3 transcript levels and protein abundance in intestinal tissue were determined by confocal immunofluorescent microscopy, RT-PCR and western blotting, cytosolic pH (pHi) in intestinal cells from 2',7'-bis-(2-carboxyethyl)-5-(and-6)-carboxyfluorescein (BCECF) fluorescence and Na+/H+ exchanger activity from the Na+ dependent realkalinization following an ammonium pulse. Results: Saline drinking significantly enhanced fluid intake and increased NHE3 transcript levels, NHE3 protein and Na+/H+ exchanger activity. Conclusions: Salt content of ingested fluid has a profound effect on intestinal Na+/H+ exchanger expression and activity.

Intestinal epithelia are exposed to alterations of Na+ concentration and osmolarities depending on the ingested food and beverages [1]. Changes of extracellular osmolarity result in the osmotic gradients and water fluxes across the cell membranes and thus lead to the respective alterations of cell volume [2,3]. Hyperosmolarity leads to cell shrinkage, hypoosmolarity to cell swelling [3]. Alterations of cell volume modify in turn a wide variety of functions including gene expression [3]. Genes up-regulated by cell shrinkage include the serum- and glucocorticoid-inducible kinase SGK1 [4], a gene originally cloned as a glucocorticoid-inducible gene [5,6] and later found to be up-regulated by mineralocorticoids [7,8,9]. SGK1 is activated by insulin and insulin-like growth factor 1 through phosphatidyl-inositide 3 (PI3) kinase and phosphoinositide-dependent kinase PDK1 [10].

SGK1 is strongly expressed in intestinal epithelia [4,11,12] and contributes to the regulation of intestinal transport [13]. SGK1 up-regulates a wide variety of epithelial channels and transporters [13], including the Na+/H+ exchanger NHE3 [14,15]. Using chamber experiments confirmed the in vivo significance of SGK1 sensitive intestinal absorption [16,17].

The present study explored whether the NaCl content of ingested fluid influences the activity of the intestinal Na+/H+ exchanger. To this end, animals were allowed access to either plain water or isotonic saline and NHE transcript levels, NHE3 protein abundance and Na+/H+ exchanger activity determined.

Animals

Experiments were performed in sex and age matched mice of 3 months of age. All animal experiments were conducted according to the German law for the care and use of laboratory animals and were approved by local authorities. The mice (8 mice in each group) were fed a control diet (C1314, Altromin, Lage, Germany, NaCl content 0.49%) and had access to either plain water or isotonic saline ad libitum. To determine food and fluid intake, the mice were placed individually in metabolic cages (Techniplast, Hohenpeissenberg, Germany). To obtain blood, mice were anaesthetized with diethylether (Roth, Karlsruhe, Germany) and blood specimens (50 - 200 μl) were withdrawn into capillaries containing EDTA by puncturing the retro-orbital plexus. To obtain tissue, the animals were anaesthetized with diethylether and sacrificed by cervical dislocation.

Immunofluorescence

Tissue samples were cut into 8 μm frozen sections from mouse jejunum and subsequently fixed in 4% paraformaldehyde for 15 min at room temperature. The sections were blocked with 5% milk in PBS 0.3% Triton 100 for 1 hour and incubated with a rabbit anti-NHE3 antibody (1:100 dilution; Novus Biologicals, USA) overnight at 4°C. Secondary FITC-conjugated goat anti-rabbit IgG (Invitrogen, Karlsruhe, Germany) was used in a 1: 1000 dilution. Nuclei were stained with DRAQ5™ (Biostatus Limited, Leicestershire, UK). Slides were mounted using the ProLang® Gold Antifade reagent (Invitrogen). Confocal microscopy was performed with Zeiss LSM 5 EXCITER confocal laser-scanning module (Carl Zeiss, Oberkochen, Germany) and images were analyzed with the software of the instrument.

Real-Time Reverse transcription polymerase chain reaction (RT-PCR)

To determine NHE3 transcript levels, total RNA was extracted from intestinal tissue in Trizol (Peqlab, Erlangen, Germany) according to the manufacturer's instructions. After DNAse digestion reverse transcription of total RNA was performed using random hexamers (Roche Diagnostics, Penzberg, Germany) and SuperScriptII reverse transcriptase (Invitrogen, Carlsbad, CA, USA). Polymerase chain reaction (PCR) amplification of the respective genes were set up in a total volume of 20 µl using 40 ng of cDNA, 500 nM forward and reverse primer and 2x iTaq Fast SYBR Green (Bio-Rad, Hercules, CA, USA) according to the manufacturer's protocol. Amplification of the house-keeping gene Tbp (TATA box binding protein) was performed to standardize the amount of sample RNA. Cycling conditions were chosen as follows: initial denaturation at 95°C for 2 min, followed by 40 cycles of 95°C for 15 sec, 55°C for 15 sec and 68°C for 20 sec. For the amplification the following primers were used (5`->3`orientation):

fw GTCACCCAGGATGTAGCCTCTG rev GGTGGCACCCTGGATAGGAT;

Western blotting

Mice were sacrificed by cervical dislocation under ether anaesthesia, and the abdomen was opened. The intestine was then longitudinally cut and cleaned with PBS. A piece of 0.5 g of intestinal tissue was added to 1 ml lysis buffer (50 mM Tris-HCl, pH 7.5, 150 mM NaCl, 1% Triton X-100, 0.5% SDS, 1 mM NaF, 1 mM Na3VO4, 0.4% β-mercaptoethanol) containing protease inhibitor cocktail (Sigma, Schnelldorf, Germany). The tissue was then homogenized with a Dounce homogenizer on ice for 30 min. Samples were centrifuged at 17,000 rpm for 20 min, and supernatants were collected. After measurement of the total protein concentration (Bradford assay), 80 µg of tissue protein were solubilized in Laemmli sample buffer at 95ºC for 5 min and resolved by 10% SDS-PAGE. For immunoblotting proteins were electro-transferred onto a PVDF membrane and blocked with 5% nonfat milk in TBS-0.10% Tween 20 at room temperature for 1 h. The membrane was then incubated with a rabbit anti-NHE3 antibody (1:1000; 84 kDa, Novus biologicals, USA) at 4°C overnight. After washing (TBST) and subsequent blocking the blot was incubated with secondary anti-rabbit antibody (1:2000, Cell Signaling) for 1 h at room temperature. After washing, antibody-binding was detected with the ECL detection reagent (Amersham, Freiburg, Germany). For loading control the blot was stripped in stripping buffer (Roth, Karlsruhe, Germany) at 56°C for 30 min. After washing with PBST the blot was blocked with TBST + 5% milk for 1 h at room temperature. The blot was then incubated with an anti GAPDH antibody (1:1000, 37 kDa, Cell Signaling) at 4°C overnight. After washing with PBST and incubation with anti-rabbit antibody (GAPDH, 1:2000, Cell Signaling), antibody-binding was detected. Bands were quantified with Quantity One Software (Biorad, Munich, Germany).

Intestinal NHE3 activity

For the isolation of ileal villi, animals were fasted for 6 hours prior to the experiments. After sacrificing the animals the terminal 2 cm of the ileum were removed and cut longitudinally. After washing with standard Hepes solution the intestine was sliced into 0.3 cm2 sections. The tissues were transferred onto the cooled stage of a dissecting microscope and the individual villi were detached from the intestine by snapping off the ileal base using sharpened microdissection tweezers. Care was taken not to touch the apical part of the villi. The villi were attached to a glass coverslip precoated with Cell-Tak adhesive (BD Biosciences, Heidelberg, Germany). For quantitative digital imaging of pHi isolated individual villi were incubated in a HEPES-buffered Ringer solution containing 10 µM 2',7'-Bis-(carboxyethyl)-5(6)-carboxyfluorescein-acetoxymethylester (BCECF-AM Molecular Probes, Leiden, The Netherlands) for 15 min at 37°C. After loading, the chamber was flushed for 5 min with Ringer solution to remove any deesterified dye sticking to the outside of the villi [18]. The perfusion chamber was mounted on the stage of an inverted microscope (Zeiss Axiovert 135, Göttingen, Germany), which was used in the epifluorescence mode with a 40x oil immersion objective (Zeiss Neoplan, Göttingen, Germany) [19]. BCECF was successively excited at 490/10 and 440/10 nm, and the resultant fluorescent signal was monitored at 535/10 nm using an intensified charge-coupled device camera (Proxitronic, Bensheim, Germany) and specialized computer software (Metafluor, Puchheim, Germany). Individual cells from the brush border of the villi were outlined and monitored during the course of the measurement. Intensity ratio data (490/440) were converted into pH values using the high-K+/ nigericin calibration technique [20,21]. To this end, the cells were perfused at the end of each experiment for 5 minutes with standard high-K+/nigericin (10 µg/ml) solution (pH 7.0). The intensity ratio data thus obtained were converted into pH values using the rmax, rmin, pKa values previously generated from calibration experiments to generate a standard nonlinear curve (pH range 5 to 8.5).

For acid loading, cells were transiently exposed to a solution containing 20 mM NH4Cl leading to initial alkalinization of cytosolic pH (pHi) due to entry of NH3 and binding of H+ to form NH4+[22] . The acidification of cytosolic pH upon removal of ammonia allowed calculating the mean intrinsic buffering power (ß) of the cells [23]. Assuming that NH4+ and NH3 are in equilibrium in cytosolic and extracellular fluid and that ammonia leaves the cells as NH3:

ß = Δ[NH4+]i/ΔpHi,

where ΔpHi is the decrease of cytosolic pH (pHi) following ammonia removal and Δ[NH4+]i is the decrease of cytosolic NH4+ concentration, which is identical to the concentration of [NH4+]i immediately before the removal of ammonia. The pK for NH4+/NH3 is 8.9 [24] and at an extracellular pH (pHo) of 7.4 the NH4+ concentration in extracellular fluid ([NH4+]o) is 19.37 mM [20/(1+10pHo-pK)]. The intracellular NH4+ concentration ([NH4]i) was calculated from:

[NH4]i = 19.37 ∙ 10pHo-pHi mM

To calculate the ΔpH/min during re-alkalinization, a manual linear fit was placed over a narrow pH range (pH 6.7 to 6.9) which could be applied to all measured cells. The solutions were composed of (in mM): standard Hepes: 115 NaCl, 5 KCl, 1 CaCl2, 1.2 MgSO4, 2 NaH2PO4,10 glucose, 32.2 Hepes; sodium free Hepes: 132.8 NMDG, 3 KCl, 1 CaCl2, 1.2 MgSO4, 2 KH2PO4, 32.2 Hepes, 10 mannitol, 10 glucose (for sodium free ammonium chloride 10 mM NMDG and mannitol were replaced with 20 mM NH4Cl); high K+ for calibration 105 KCl, 1 CaCl2, 1.2 MgSO4, 32.2 Hepes, 10 mannitol, 5 µM nigericin. The pH of the solutions was titrated to 7.4 or 7.0 with HCl/NaOH, HCl/NMDG and HCl/KOH, respectively, at 37°C.

Statistics

Data are provided as means ± SEM, n represents the number of independent experiments. All data were tested for significance using Student t-test or ANOVA (Dunnet's test), where applicable, and only results with P < 0.05 were considered statistically significant.

To determine the impact of NaCl intake on fluid and food intake, animals were placed into metabolic cages. As shown in Figure 1, the fluid intake was significantly higher in saline drinking than in water drinking animals. The food intake was not significantly different between animals drinking saline and animals drinking water (Fig. 1).

Fig. 1

Food and fluid uptake of animals drinking water or saline. Arithmetic means ± SEM (n = 8-12) of food (left panel) and fluid (right panel) uptake of animals drinking water (H2O, white bars) or saline (NaCl, black bars).

Fig. 1

Food and fluid uptake of animals drinking water or saline. Arithmetic means ± SEM (n = 8-12) of food (left panel) and fluid (right panel) uptake of animals drinking water (H2O, white bars) or saline (NaCl, black bars).

Close modal

Confocal microscopy was utilized to elucidate, whether NaCl intake influences the expression of the Na+/H+ exchanger NHE3. As illustrated in Fig. 2, NHE3 protein abundance was indeed higher in saline drinking than in water drinking mice. To quantify the expression of the intestinal Na+/H+ exchanger, NHE3 transcript levels were determined by RT-PCR and membrane protein abundance by Western blotting. As shown in Fig. 3, the NHE3 transcript levels were significantly higher in saline drinking animals than in water drinking animals. A similar observation was made utilizing Western blotting. The NHE3 protein abundance was again significantly higher in saline drinking animals than in water drinking animals.

Fig. 2

NHE3 expression in intestinal tissue of animals drinking water or saline. Immunofluorescence of NHE3 protein expression (green) in intestinal tissue from animals drinking water (H2O) or saline (NaCl).

Fig. 2

NHE3 expression in intestinal tissue of animals drinking water or saline. Immunofluorescence of NHE3 protein expression (green) in intestinal tissue from animals drinking water (H2O) or saline (NaCl).

Close modal
Fig. 3

NHE3 transcript and protein abundance in intestinal brush border of animals drinking water or saline. A: Arithmetic means ± SEM (n = 6) of NHE3 transcript levels (in arbitrary units, a.u.) in intestinal tissue from animals drinking water (H2O, white bar) or saline (NaCl, black bar) * indicates statistically significant difference (p<0.05) from H2O drinking animals. B: Original Western blot of HE3 protein abundance in intestinal tissue from animals drinking water (H2O, white bars) or saline (NaCl, black bars). C: Arithmetic means ± SEM (n = 6) of NHE3 protein density (in arbitrary units, a.u.) in intestinal tissue from animals drinking water (H2O, white bars) or saline (NaCl, black bars). * indicates statistically significant difference (p<0.05) from H2O drinking animals.

Fig. 3

NHE3 transcript and protein abundance in intestinal brush border of animals drinking water or saline. A: Arithmetic means ± SEM (n = 6) of NHE3 transcript levels (in arbitrary units, a.u.) in intestinal tissue from animals drinking water (H2O, white bar) or saline (NaCl, black bar) * indicates statistically significant difference (p<0.05) from H2O drinking animals. B: Original Western blot of HE3 protein abundance in intestinal tissue from animals drinking water (H2O, white bars) or saline (NaCl, black bars). C: Arithmetic means ± SEM (n = 6) of NHE3 protein density (in arbitrary units, a.u.) in intestinal tissue from animals drinking water (H2O, white bars) or saline (NaCl, black bars). * indicates statistically significant difference (p<0.05) from H2O drinking animals.

Close modal

NHE3 activity was estimated from the pH recovery following an ammonium pulse in intestinal cells isolated from ileum of animals drinking either water or saline. Prior to exposure of the intestinal cells to ammoniumchloride, cytosolic pH (pHi) was similar in saline and water drinking animals (Table 1). In intestinal cells from both, water and saline drinking animals, the application of 20 mM NH4Cl was followed by cytosolic alkalinization due to entry of NH3 with subsequent binding of intracellular H+. The subsequent NH4+ removal was followed by a sharp cytosolic acidification due to exit of NH3 with cellular retention of H+. The alterations of pHi following an ammonium pulse allowed calculating the cellular buffer capacity (see methods), which was again similar in intestinal cells from water and saline drinking animals (Table 1). In the absence of extracellular Na+, cytosolic pH remained acidic pointing to lack of Na+ independent acid extrusion. The addition of Na+ resulted in a rapid realkalinization, reflecting Na+/H+ exchanger activity. The pHi recovery in the presence of extracellular Na+ was significantly more rapid in intestinal cells isolated from saline drinking animals than in intestinal cells isolated from water drinking animals (Figure 4). Thus, saline drinking upregulates the intestinal Na+/H+ exchanger activity.

Table 1

Cytosolic pH (pHi), buffer capacity (mM/pH unit), Na+-independent pH recovery (Δ pH units/minute) and sodium-dependent pH recovery (Δ pH units/minute) in intestinal epithelial cells from mice offered normal drinking water (H2O) or 0.9 % saline water (NaCl)

Cytosolic pH (pHi), buffer capacity (mM/pH unit), Na+-independent pH recovery (Δ pH units/minute) and sodium-dependent pH recovery (Δ pH units/minute) in intestinal epithelial cells from mice offered normal drinking water (H2O) or 0.9 % saline water (NaCl)
Cytosolic pH (pHi), buffer capacity (mM/pH unit), Na+-independent pH recovery (Δ pH units/minute) and sodium-dependent pH recovery (Δ pH units/minute) in intestinal epithelial cells from mice offered normal drinking water (H2O) or 0.9 % saline water (NaCl)
Fig. 4

pH recovery following an ammonium pulse in ileum from of animals drinking water or saline. Alterations of cytosolic pH (∆pH) in ileal epithelial cells following an ammonium pulse. To load the cells with H+, 20 mM NH4Cl was added and Na+ removed (replaced by NMDG; ‘0' Na+) in a first step (see bars below each tracing), NH4Cl removed in a second step (NH4+), Na+ added in a third step and nigericin (pH₀ ‘7') applied in a fourth step to calibrate each individual experiment. A: Representative experiments showing time dependent alterations of pH in isolated intestinal villi from animals drinking water (H2O, left panel) or saline (NaCl, right panel). B: Arithmetic means ± SEM (n = 8 mice) of pHi in intestinal cells from animals drinking water (H2O, white bars) or 0.9 % saline (NaCl, black bars). C: Arithmetic means ± SEM (n = 8 mice) of sodium dependent pH recovery in intestinal cells from animals drinking water (H2O, white bars) or saline (NaCl, black bars). * indicates statistically significant difference (p<0.05) from H2O drinking animals.

Fig. 4

pH recovery following an ammonium pulse in ileum from of animals drinking water or saline. Alterations of cytosolic pH (∆pH) in ileal epithelial cells following an ammonium pulse. To load the cells with H+, 20 mM NH4Cl was added and Na+ removed (replaced by NMDG; ‘0' Na+) in a first step (see bars below each tracing), NH4Cl removed in a second step (NH4+), Na+ added in a third step and nigericin (pH₀ ‘7') applied in a fourth step to calibrate each individual experiment. A: Representative experiments showing time dependent alterations of pH in isolated intestinal villi from animals drinking water (H2O, left panel) or saline (NaCl, right panel). B: Arithmetic means ± SEM (n = 8 mice) of pHi in intestinal cells from animals drinking water (H2O, white bars) or 0.9 % saline (NaCl, black bars). C: Arithmetic means ± SEM (n = 8 mice) of sodium dependent pH recovery in intestinal cells from animals drinking water (H2O, white bars) or saline (NaCl, black bars). * indicates statistically significant difference (p<0.05) from H2O drinking animals.

Close modal

The present results uncover a novel effect of beverage salt content on intestinal function. The ingestion of saline as compared to water leads to up-regulation of the intestinal Na+/H+ exchanger, the major carrier accomplishing intestinal Na+ absorption.

The present observations did not address the mechanisms accomplishing the up-regulation of Na+/H+ exchanger activity in saline-drinking animals. In theory, the effect of saline ingestion on Na+/H+ exchanger activity could have resulted from stimulation of Na+/H+ exchanger activity by the serum- and glucocorticoid-inducible kinase SGK1, which is up-regulated by cell shrinkage [4] and is a powerful stimulator of the Na+/H+ exchanger NHE3 [14,15,25,26]. SGK1 further up-regulates the Na+/K+-ATPase [27,28,29,30], which extrudes cytosolic Na+ and thus establishes the driving force for secondary active transporters such as Na+/H+ exchangers. SGK1 has previously been shown to participate in the signaling mediating the stimulation of the intestinal Na+/H+ exchanger NHE3 by the glucocorticoid dexamethasone [16]. Glucocorticoids stimulate the intestinal transport of nutrients [31] and via Na+/H+ exchanger NHE3 the Na+ absorption [32,33,34]. SGK1 enhances the cell membrane protein abundance of a wide variety of ion channels and carriers [13,35] including NHE3 [14,15]. Thus, SGK1 is critically important for the effects of glucocorticoids on intestinal transport. Accordingly, the effect of glucocorticoids on NHE3 were strongly attenuated in gene-targeted mice lacking functional SGK1 [16].

Drinking water decreases but does not fully abolish Na+/H+ exchanger activity. Similarly, complete lack of SGK1 in the SGK1 knockout mice does not result in complete lack of Na+/H+ exchanger activity [16]. The residual Na+/H+ exchanger activity in SGK1 deficient mice may result from stimulation of the carrier by similar kinases, such as the SGK1 isoform SGK3 [36], which, similar to SGK1 stimulates several channels and transporters [13]. In contrast to SGK1, SGK3 is not genomically regulated by cell volume or glucocorticoids [13]. Accordingly, the effect of beverage osmolarity may affect the expression of SGK1 but not of SGK3. Both, SGK1 and SGK3 are activated by insulin and growth factors via phosphoinositide 3 kinase (PI3K) and phosphoinositide dependent kinase PDK1 [10].

SGK1 transcription is further up-regulated by mineralocorticoids [7,8,9]. The kinase stimulates the Na+ transport not only in intestine [16] but as well in the kidney [7,37,38,39,40,41]. Presumably due to its effect on NaCl homeostasis, SGK1 affects blood pressure [13]. A gain of function variant of the SGK1 gene is associated with increased blood pressure [13], which is one hallmark of metabolic syndrome or syndrome X, a condition characterized by essential hypertension, procoagulant state, obesity, insulin resistance and hyperinsulinemia [42] and associated with enhanced morbidity and mortality from cardiovascular disease [43,44,45].

Even though SGK1 may be a candidate for the upregulation of NHE3 following saline ingestion, the present data do not allow firm conclusions regarding the mechanisms accomplishing the altered regulation of Na+/H+ exchanger activity in water- and saline-drinking animals. In theory, the increase of Na+/H+ exchanger activity could have resulted from cytosolic acidification, which is known to stimulate Na+/H+ exchanger activity [46]. The Na+/H+ exchanger is further stimulated by cell shrinkage [2,3], which, however, affects NHE1 rather than NHE3 [47]. NHE3 is further upregulated by inhibition of protein kinase A [48]. NHE3 could be stimulated by direct exposure to ingested saline or indirectly by local reflexes, intestinal mediators or hormones. Clearly, additional experiments are needed to elucidate the mechanisms involved in the stimulation of intestinal Na+/H+ exchanger activity by saline-drinking. Whatever mechanism involved, any up-regulation of NH3 activity in intestine and kidney could contribute to the development of hypertension following saline ingestion [48,49,50,51,52,53,54,55].

As compared to drinking water, drinking saline increases the activity of the Na+/H+ exchanger, which impacts on intestinal salt transport.

The authors state that they have no conflict of interest to disclose.

The authors gratefully acknowledge the meticulous preparation of the manuscript by Lejla Subasic. The study has been supported by DFG and Open Access Publishing Fund of Tuebingen University.

1.
Lim CH, Bot AG, de Jonge HR, Tilly BC: Osmosignaling and volume regulation in intestinal epithelial cells. Methods Enzymol 2007;428:325-342.
2.
Hoffmann EK, Lambert IH, Pedersen SF: Physiology of cell volume regulation in vertebrates. Physiol Rev 2009;89:193-277.
3.
Lang F, Busch GL, Ritter M, Volkl H, Waldegger S, Gulbins E, Haussinger D: Functional significance of cell volume regulatory mechanisms. Physiol Rev 1998;78:247-306.
4.
Waldegger S, Barth P, Raber G, Lang F: Cloning and characterization of a putative human serine/threonine protein kinase transcriptionally modified during anisotonic and isotonic alterations of cell volume. Proc Natl Acad Sci U S A 1997;94:4440-4445.
5.
Firestone GL, Giampaolo JR, O'Keeffe BA: Stimulus-dependent regulation of the serum and glucocorticoid inducible protein kinase (Sgk) transcription, subcellular localization and enzymatic activity. Cell Physiol Biochem 2003;13:1-12.
6.
Webster MK, Goya L, Ge Y, Maiyar AC, Firestone GL: Characterization of sgk, a novel member of the serine/threonine protein kinase gene family which is transcriptionally induced by glucocorticoids and serum. Mol Cell Biol 1993;13:2031-2040.
7.
Chen SY, Bhargava A, Mastroberardino L, Meijer OC, Wang J, Buse P, Firestone GL, Verrey F, Pearce D: Epithelial sodium channel regulated by aldosterone-induced protein sgk. Proc Natl Acad Sci U S A 1999;96:2514-2519.
8.
Naray-Fejes-Toth A, Canessa C, Cleaveland ES, Aldrich G, Fejes-Toth G: Sgk is an aldosterone-induced kinase in the renal collecting duct. Effects on epithelial Na+ channels. J Biol Chem 1999;274:16973-16978.
9.
Shigaev A, Asher C, Latter H, Garty H, Reuveny E: Regulation of sgk by aldosterone and its effects on the epithelial Na(+) channel. Am J Physiol Renal Physiol 2000;278:F613-F619.
10.
Lang F, Cohen P: Regulation and physiological roles of serum- and glucocorticoid-induced protein kinase isoforms. Sci STKE 2001;2001:RE17.
11.
Coric T, Hernandez N, de la Rosa DA, Shao D, Wang T, Canessa CM: Expression of ENaC and serum- and glucocorticoid-induced kinase 1 in the rat intestinal epithelium. Am J Physiol Gastrointest Liver Physiol 2004;286:G663-G670.
12.
Waldegger S, Klingel K, Barth P, Sauter M, Rfer ML, Kandolf R, Lang F: h-sgk serine-threonine protein kinase gene as transcriptional target of transforming growth factor beta in human intestine. Gastroenterology 1999;116:1081-1088.
13.
Lang F, Bohmer C, Palmada M, Seebohm G, Strutz-Seebohm N, Vallon V: (Patho)physiological significance of the serum- and glucocorticoid-inducible kinase isoforms. Physiol Rev 2006;86:1151-1178.
14.
Yun CC, Chen Y, Lang F: Glucocorticoid activation of Na(+)/H(+) exchanger isoform 3 revisited. The roles of SGK1 and NHERF2. J Biol Chem 2002;277:7676-7683.
15.
Yun CC: Concerted Roles of SGK1 and the Na+/H+ Exchanger Regulatory Factor 2 (NHERF2) in Regulation of NHE3. Cell Physiol Biochem 2003;13:029-040.
16.
Grahammer F, Henke G, Sandu C, Rexhepaj R, Hussain A, Friedrich B, Risler T, Metzger M, Just L, Skutella T, Wulff P, Kuhl D, Lang F: Intestinal function of gene-targeted mice lacking serum- and glucocorticoid-inducible kinase 1. Am J Physiol Gastrointest Liver Physiol 2006;290:G1114-G1123.
17.
Rexhepaj R, Rotte A, Kempe DS, Sopjani M, Foller M, Gehring EM, Bhandaru M, Gruner I, Mack AF, Rubio-Aliaga I, Nassl AM, Daniel H, Kuhl D, Lang F: Stimulation of electrogenic intestinal dipeptide transport by the glucocorticoid dexamethasone. Pflugers Arch 2009;459:191-202.
18.
Rotte A, Pasham V, Eichenmuller M, Yang W, Qadri SM, Bhandaru M, Lang F: Regulation of basal gastric acid secretion by the glycogen synthase kinase GSK3. J Gastroenterol 2010;45:1022-1032.
19.
Rotte A, Pasham V, Mack AF, Bhandaru M, Qadri SM, Eichenmuller M, Ruth P, Lang F: Ca2+ activated K+ channel Kca3.1 as a determinant of gastric acid secretion. Cell Physiol Biochem 2011;27:597-604.
20.
Waisbren SJ, Geibel J, Boron WF, Modlin IM: Luminal perfusion of isolated gastric glands. Am J Physiol 1994;266:C1013-C1027.
21.
Bhandaru M, Pasham V, Yang W, Bobbala D, Rotte A, Lang F: Effect of azathioprine on Na(+)/H(+) exchanger activity in dendritic cells. Cell Physiol Biochem 2012;29:533-542.
22.
Rotte A, Pasham V, Bhandaru M, Bobbala D, Zelenak C, Lang F: Rapamycin sensitive ROS formation and Na(+)/H(+) exchanger activity in dendritic cells. Cell Physiol Biochem 2012;29:543-550.
23.
Rotte A, Pasham V, Eichenmuller M, Yang W, Bhandaru M, Lang F: Influence of dexamethasone on Na+/H+ exchanger activity in dendritic cells. Cell Physiol Biochem 2011;28:305-314.
24.
Boyarsky G, Ganz MB, Sterzel RB, Boron WF: pH regulation in single glomerular mesangial cells. I. Acid extrusion in absence and presence of HCO3-. Am J Physiol 1988;255:C844-C856.
25.
Hryciw DH, Kruger WA, Briffa JF, Slattery C, Bolithon A, Lee A, Poronnik P: Sgk-1 is a Positive Regulator of Constitutive Albumin Uptake in Renal Proximal Tubule Cells. Cell Physiol Biochem 2012;30:1215-1226.
26.
Slattery C, Jenkin KA, Lee A, Simcocks AC, McAinch AJ, Poronnik P, Hryciw DH: Na+-H+ exchanger regulatory factor 1 (NHERF1) PDZ scaffold binds an internal binding site in the scavenger receptor megalin. Cell Physiol Biochem 2011;27:171-178.
27.
Henke G, Setiawan I, Bohmer C, Lang F: Activation of Na(+)/K(+)-ATPase by the Serum and Glucocorticoid-Dependent Kinase Isoforms. Kidney Blood Press Res 2002;25:370-374.
28.
Setiawan I, Henke G, Feng Y, Bohmer C, Vasilets LA, Schwarz W, Lang F: Stimulation of Xenopus oocyte Na(+),K(+)ATPase by the serum and glucocorticoid-dependent kinase sgk1. Pflugers Arch 2002;444:426-431.
29.
Verrey F, Loffing J, Zecevic M, Heitzmann D, Staub O: SGK1: aldosterone-induced relay of Na+ transport regulation in distal kidney nephron cells. Cell Physiol Biochem 2003;13:021-028.
30.
Zecevic M, Heitzmann D, Camargo SM, Verrey F: SGK1 increases Na,K-ATP cell-surface expression and function in Xenopus laevis oocytes. Pflugers Arch 2004;448:29-35.
31.
Iannoli P, Miller JH, Ryan CK, Sax HC: Glucocorticoids upregulate intestinal nutrient transport in a time-dependent and substrate-specific fashion. J Gastrointest Surg 1998;2:449-457.
32.
Kiela PR, Guner YS, Xu H, Collins JF, Ghishan FK: Age- and tissue-specific induction of NHE3 by glucocorticoids in the rat small intestine. Am J Physiol Cell Physiol 2000;278:C629-C637.
33.
Li S, Sato S, Yang X, Preisig PA, Alpern RJ: Pyk2 activation is integral to acid stimulation of sodium/hydrogen exchanger 3. J Clin Invest 2004;114:1782-1789.
34.
Wormmeester L, Sanchez dM, Kokke F, Tse CM, Khurana S, Bowser J, Cohen ME, Donowitz M: Quantitative contribution of NHE2 and NHE3 to rabbit ileal brush-border Na+/H+ exchange. Am J Physiol 1998;274:C1261-C1272.
35.
Schmidt EM, Kraemer BF, Borst O, Munzer P, Schonberger T, Schmidt C, Leibrock C, Towhid ST, Seizer P, Kuhl D, Stournaras C, Lindemann S, Gawaz M, Lang F: SGK1 sensitivity of platelet migration. Cell Physiol Biochem 2012;30:259-268.
36.
Kobayashi T, Deak M, Morrice N, Cohen P: Characterization of the structure and regulation of two novel isoforms of serum- and glucocorticoid-induced protein kinase. Biochem J 1999;344:189-197.
37.
Alvarez de la Rosa D, Zhang P, Naray-Fejes-Toth A, Fejes-Toth G, Canessa CM: The serum and glucocorticoid kinase sgk increases the abundance of epithelial sodium channels in the plasma membrane of Xenopus oocytes. J Biol Chem 1999;274:37834-37839.
38.
Böhmer C, Wagner CA, Beck S, Moschen I, Melzig J, Werner A, Lin JT, Lang F, Wehner F: The shrinkage-activated Na(+) conductance of rat hepatocytes and its possible correlation to rENaC. Cell Physiol Biochem 2000;10:187-194.
39.
Lang F, Klingel K, Wagner CA, Stegen C, Warntges S, Friedrich B, Lanzendorfer M, Melzig J, Moschen I, Steuer S, Waldegger S, Sauter M, Paulmichl M, Gerke V, Risler T, Gamba G, Capasso G, Kandolf R, Hebert SC, Massry SG, Broer S: Deranged transcriptional regulation of cell-volume-sensitive kinase hSGK in diabetic nephropathy. Proc Natl Acad Sci U S A 2000;97:8157-8162.
40.
Loffing J, Zecevic M, Feraille E, Kaissling B, Asher C, Rossier BC, Firestone GL, Pearce D, Verrey F: Aldosterone induces rapid apical translocation of ENaC in early portion of renal collecting system: possible role of SGK. Am J Physiol Renal Physiol 2001;280:F675-F682.
41.
Wagner CA, Ott M, Klingel K, Beck S, Melzig J, Friedrich B, Wild KN, Broer S, Moschen I, Albers A, Waldegger S, Tummler B, Egan ME, Geibel JP, Kandolf R, Lang F: Effects of the serine/threonine kinase SGK1 on the epithelial Na(+) channel (ENaC) and CFTR: implications for cystic fibrosis. Cell Physiol Biochem 2001;11:209-218.
42.
Roth JL, Mobarhan S, Clohisy M: The Metabolic Syndrome: where are we and where do we go? Nutr Rev 2002;60:335-337.
43.
Isomaa B, Henricsson M, Almgren P, Tuomi T, Taskinen MR, Groop L: The metabolic syndrome influences the risk of chronic complications in patients with type II diabetes. Diabetologia 2001;44:1148-1154.
44.
Marceau F, Larrivee JF, Bouthillier J, Bachvarova M, Houle S, Bachvarov DR: Effect of endogenous kinins, prostanoids, and NO on kinin B1 and B2 receptor expression in the rabbit. Am J Physiol 1999;277:R1568-R1578.
45.
Opherk D, Schuler G, Wetterauer K, Manthey J, Schwarz F, Kubler W: Four-year follow-up study in patients with angina pectoris and normal coronary arteriograms ("syndrome X"). Circulation 1989;80:1610-1616.
46.
Grinstein S, Cohen S, Goetz JD, Rothstein A: Na+/H+ exchange in volume regulation and cytoplasmic pH homeostasis in lymphocytes. Fed Proc 1985;44:2508-2512.
47.
Alexander RT, Grinstein S: Na+/H+ exchangers and the regulation of volume. Acta Physiol (Oxf) 2006;187:159-167.
48.
Queiroz-Leite GD, Crajoinas RO, Neri EA, Bezerra CN, Girardi AC, Reboucas NA, Malnic G: Fructose Acutely Stimulates NHE3 Activity in Kidney Proximal Tubule. Kidney Blood Press Res 2012;36:320-334.
49.
Soleimani M: Dietary fructose, salt absorption and hypertension in metabolic syndrome: towards a new paradigm. Acta Physiol (Oxf) 2011;201:55-62.
50.
Ackermann TF, Boini KM, Beier N, Scholz W, Fuchss T, Lang F: EMD638683, a novel SGK inhibitor with antihypertensive potency. Cell Physiol Biochem 2011;28:137-146.
51.
Ando K, Fujita T: Pathophysiology of salt sensitivity hypertension. Ann Med 2012;44:S119-S126.
52.
Choi JW, Park JS, Koo TY, Lee CH, Kang CM, Kim GH: Fractional excretion of uric Acid as a predictor for saline responsiveness in long-term kidney transplant patients. Kidney Blood Press Res 2012;35:627-633.
53.
Fujita Y, Kojima H, Hidaka H, Fujimiya M, Kashiwagi A, Kikkawa R: Increased intestinal glucose absorption and postprandial hyperglycaemia at the early step of glucose intolerance in Otsuka Long-Evans Tokushima Fatty rats. Diabetologia 1998;41:1459-1466.
54.
Saeed A, Dibona GF, Guron G: Effects of Endothelin Receptor Antagonists on Renal Hemodynamics in Angiotensin II-Infused Rats on High NaCl Intake. Kidney Blood Press Res 2012;36:258-267.
55.
Shimosawa T, Mu S, Shibata S, Fujita T: The kidney and hypertension: pathogenesis of salt-sensitive hypertension. Curr Hypertens Rep 2012;14:468-472.

Venkanna Pashama and Anand Rottea contributed equally and thus share first authorship

Open Access License / Drug Dosage / Disclaimer
Open Access License: This is an Open Access article licensed under the terms of the Creative Commons Attribution-NonCommercial 3.0 Unported license (CC BY-NC) (www.karger.com/OA-license), applicable to the online version of the article only. Distribution permitted for non-commercial purposes only.
Drug Dosage: The authors and the publisher have exerted every effort to ensure that drug selection and dosage set forth in this text are in accord with current recommendations and practice at the time of publication. However, in view of ongoing research, changes in government regulations, and the constant flow of information relating to drug therapy and drug reactions, the reader is urged to check the package insert for each drug for any changes in indications and dosage and for added warnings and precautions. This is particularly important when the recommended agent is a new and/or infrequently employed drug.
Disclaimer: The statements, opinions and data contained in this publication are solely those of the individual authors and contributors and not of the publishers and the editor(s). The appearance of advertisements or/and product references in the publication is not a warranty, endorsement, or approval of the products or services advertised or of their effectiveness, quality or safety. The publisher and the editor(s) disclaim responsibility for any injury to persons or property resulting from any ideas, methods, instructions or products referred to in the content or advertisements.