Introduction: It is suggested that Epstein-Barr virus (EBV) may play an important role in cervical cancer development. Most studies found a higher rate of EBV in cervical cancer samples in comparison to premalignant and normal groups. In this regard, this study aimed to investigate the prevalence of EBV in cervical samples. Methods: In total, 364 samples from 179 healthy subjects, 124 women with premalignant lesions, and 61 patients with cervical cancer were investigated using nested-PCR. Results: The mean age ± SE was 54.1 ± 13.4 in women with cervical cancer, 36.1 ± 9.4 among women with premalignant lesions, and 36.6 ± 11.5 in healthy individuals. In total, 290 out of 364 samples were human papillomavirus (HPV) positive and the following HPV genotypes were detected among them: HPV 16/18 was found in 43.1%, 23.9%, and 65.5% of normal, premalignant, and malignant samples, respectively, and other high-risk types were detected in 56.9% of normal, 76.1% of premalignant, and 34.5% of malignant samples. The prevalence of EBV was found to be 9.8%, 2.4%, and 2.8% in cervical cancer, premalignant lesions, and normal specimens, respectively, and the difference was statistically significant (p = 0.028). The overall frequency of coinfection between EBV and HPV was shown to be 3.6%. The coinfection was more prevalent among HPV 16/18-infected samples than other high-risk HPVs (6.6 vs. 2.9%) although the difference was not reached a statistically significant difference (p = 0.23). Conclusion: Our findings indicated that EBV could play an important role as a cofactor in the progression of cervical cancer. However, future studies with larger sample sizes and the expression analysis of EBV transcripts or proteins are mandatory.

Cervical cancer is the fourth most frequent cancer worldwide with an estimated 661,044 new cases and 348,186 new deaths in 2022 [1, 2]. The overall age-standardized rate (ASR) of cervical cancer is reported to be 6.5 per 100,000 in Iranian women. However, the ASR of this cancer varied in different provinces as the highest rate was reported in Khorasan Razavi and Yazd with an ASR >10 and the lowest rate was estimated to be <3 in several provinces located in West, Southwest, South, and Southeast of Iran [3].

Human papillomavirus (HPV) is considered the most common viral sexually transmitted infection and it is well-documented to be the etiological agent of cervical cancer [4, 5]. While the most percentage of HPV infections commonly clear up within 6–24 months after acquisition, a small percentage of infections with 14 high-risk HPV types (HPV 16, 18, 31, 33, 35, 39, 45, 51, 52, 56, 58, 59, 66, and 68) can persist and lead to cervical cancer development. Among 14 high-risk HPV types, HPV 16 and 18 are the leading cause and are responsible for almost 73% of cervical cancer [4‒7]. Although HPV infection is required for cervical cancer development, it is not enough, and other factors including genetic and environmental factors (oral contraceptive pills, number of lifetime sexual partners, smoking, and other infectious agents) are involved in this regard [8‒10]. It is proposed that some viruses (herpesviruses and HIV), bacteria (Chlamydia trachomatis), fungi, and parasites can play an important role as a cofactor in the development of cervical cancer [11‒15].

Epstein-Barr virus (EBV) establishes a life-long latent infection in host cells with the limited expression of several viral genes. EBV spreads generally through bodily fluids, especially saliva. The virus can be also transmitted via sexual contact. Indeed, EBV was found in vaginal, urethral fluid, and semen [16]. EBV can cause several cancers, including Burkitt’s lymphoma, nasopharyngeal carcinoma, Hodgkin’s lymphoma, and gastric cancer [17‒19].

There are several studies according to EBV prevalence in patients with cervical cancer worldwide. Most studies found an association between EBV and the progression of cervical cancer although few studies failed to find any associations [13, 20‒23]. Concerning the fact that the main transmission route of HPV is through sexual contact and EBV can be transmitted via sexual contact, it is reasonable to suppose that coinfection of HPV and EBV may have played a significant role in the progression of cervical cancer. It is suggested that EBV may play an important role in cervical cancer development. Indeed, it is shown that LMP1 and HPV 16 E6 co-expression decreases components of DNA damage response and promotes cell proliferation, anchorage-independent growth, resistance to apoptosis, and tumor-formation ability in nude mice [24].

To our knowledge, there is only one study in Iran that investigated the prevalence of EBV in premalignant and malignant samples [25]. However, this study is the first report assessing the frequency of the EBV genome not only in premalignant and malignant cervical samples but also among normal specimens. The purpose of this study was to investigate the prevalence of EBV in cervical samples. The prevalence of HPV and EBV coinfection was also estimated in malignant, premalignant, and normal cervical samples.

Samples

In this study, 364 cervical samples of cancer tissues (n = 61), premalignant lesions (n = 124), and healthy subjects (n = 179) were included. Regarding sample types, 114 samples were formalin-fixed paraffin-embedded tissue (FFPE) and 250 samples were Thin-Prep Pap Test. FFPE samples were obtained from Imam-Khomeini Hospital in Tehran and Al-Zahra Hospital in West Azarbayjan from 2017 to 2019. Thin-Prep Pap Test specimens were collected from three referral laboratories in Tehran from 2017 to 2019. All 61 samples of cervical cancer and 53 samples of premalignant lesions were FFPE and HPV types were undetermined in these samples. However, 71 samples of premalignant lesions and all of 179 normal samples were Thin-Prep Pap Test specimens and all of these samples were previously genotyped for HPV genotypes. All participants signed informed consent to the study which was approved by the Local Research Ethics Committee of Tehran University of Medical Sciences (approval No: IR.TUMS.SPH.REC.1399.298).

DNA Extraction

DNA extraction from Thin-Prep Pap Test samples was carried out using the High Pure Viral Nucleic Acid Kit (Roche Diagnostics GmbH, Berlin, Germany) according to the manufacturer’s instructions. Isolation of DNA from FFPE samples was done according to previously published procedures [26]. Briefly, a 10-μm section of tissue biopsies was treated twice with xylene and twice with absolute ethanol to remove paraffin and organic solvents, respectively. Tissue samples were then digested using lysis buffer (10 mm Tris-HCl pH 7.6, 5 mm EDTA, 150 mm NaCl, 1% SDS) containing 150 μg/mL proteinase K and incubated at 56°C for 3 h. DNA purification was carried out by phenol-chloroform extraction assay, followed by ethanol precipitation in 0.3 m sodium acetate (pH 4.6). The quality of extracted DNA from FFPE tissues was assessed by amplification of a 268 bp amplicon of the beta-globin gene [27]. Following to DNA integrity assessment, it is shown that all 114 FFPE samples were appropriate to detect of EBV genome.

PCR Amplification of L1 Gene of HPV to Genotyping

Extracted DNA of all FFPE samples (114 samples) was targeted to amplify a 150 bp fragment of HPV L1 gene using nested-PCR by MY09/MY11 and GP5+/GP6+ primer pairs [28]. The PCR reactions were carried out in a 50 μL reaction mixture including 100–200 ng of extracted DNA, 2.5 mm of MgCl2, 50 mm of each dNTP, 10 pmol of each primer, and 2 U of Taq DNA polymerase. Thermal cycles were as follows for the first and second rounds: an initial 3-min denaturation at 94°C, followed by 35 cycles of 94°C for 30 s, 50°C for 45 s, and 72°C for 1 min (first round) and 35 cycles of 95°C for 30 s, 52°C for 40 s, and 72°C for 45 s (second round), and a final elongation for 5 min at 72°C. The PCR products were run on a 2% agarose gel.

The PCR products were sequenced by BigDye® Terminator v3.1 Cycle Sequencing Kit and a 3,130 Genetic Analyzer Automated Sequencer as specified by Applied Biosystems manuals (Foster City, CA, USA). Nucleotide sequences were edited using BioEdit software and converted to FASTA format. Finally, edited sequences were blasted using the Blast server (http://www.ncbi.nlm.nih.gov/blast/) to find HPV genotypes.

PCR Amplification of the EBNA1 and LMP1 Genes of EBV

EBNA1 gene of EBV was amplified using nested-PCR to obtain a 203 bp fragment by following primer pairs: EBV-F1: AGATGACCCAGGAGAAGGCCCAAGC/EBV-R1: ACA​CCA​TTG​AGT​CGT​CTC​CCC​TTT​G (outer primers) and EBV-F2: GTTTGGAAAGCATCGTGGTCA/EBV-R2: CGA​CAT​TGT​GGA​ATA​GCA​AGG​G (inner primers). The PCR reaction was performed in a 50 μL reaction mixture including 100–200 ng of DNA template, 2 mm MgCl2, 10 pmol of each primer, 50 μm of each dNTP, and 1.5 U of Taq DNA polymerase under thermal cycles: 35 cycles of 95°C for 30 s, 58°C for 30 s, and 72°C for 30 s (first round) and 35 cycles of 95°C for 25 s, 58°C for 30 s, and 72°C for 30 s. The PCR of the LMP1 gene was also done in all samples with the primer pair of TTG​GAG​ATT​CTC​TGG​CGA​CT and AGT​CAT​CGT​GGT​GGT​GTT​CA to obtain a 219 bp fragment by the following thermal cycle conditions: 40 cycles of 95°C for 30 s, 57°C for 30 s, and 72°C for 30 s. In each run of PCR, a negative control without DNA temple was included. In the end, the PCR products were run on a 2% agarose gel.

Statistical Analysis

Statistical analysis was carried out using EPI Info 7 Statistical Analysis System Software (Atlanta, GA, USA). To test, the χ2 or Fisher exact tests were applied and the p value was considered statistically significant when it was <0.05.

In this study, the frequency of EBV was investigated among 364 cervical samples including 250 Thin-prep samples and 114 FFPE specimens obtained from women with cervical cancer (n = 61), premalignant lesions (n = 124), and healthy subjects (n = 179). Among 61 cervical cancer samples, the pathology diagnosis of 50 cases was squamous cell carcinoma (81.9%) and 11 cases were diagnosed as adenocarcinoma (18.1%). The mean age ± SE was 54.1 ± 13.4 in women with cervical cancer, 36.1 ± 9.4 among women with premalignant lesions, and 36.6 ± 11.5 in healthy individuals.

In total, 290 samples were HPV positive (all cervical samples [n = 61], 92 out of 124 premalignant samples [74.2%], and 137 out of 179 normal samples [76.5%]), and the remaining samples (n = 74) were HPV negative (32 and 42 of premalignant and normal samples, respectively). The HPV genotypes of 290 HPV-positive samples stratified by cytology/histology status were as follows: HPV 16/18 was found in 43.1% (n = 59), 23.9% (n = 22), and 65.5% (n = 40) of normal, premalignant, and malignant samples, respectively, and other high-risk types including HPV 31, 33, 35, 39, 45, 51, 52, 56, 58, and 59 were detected in 56.9% (n = 78) of normal, 76.1% (n = 70) of premalignant, and 34.5% (n = 21) of malignant samples.

The prevalence of EBV was shown to be 11.4%, 3.3%, and 2.8% regarding to EBNA1 gene in cervical cancer, premalignant lesions, and normal samples, respectively. However, the EBV LMP1 gene was detected in 11.1%, 2.5%, and 2.8% of malignant, premalignant, and normal samples, respectively. No LMP1 gene was detected in all samples that were negative for the EBNA1 gene and two cases that were positive for EBNA1 (Table 1).

Table 1.

The frequency of EBV based on the detection of EBNA1 and LMP1 genes

Pathological stagesEBV genome
EBNA1 geneLMP1 genetotal, N (%)
positive, N (%)negative, N (%)positive, N (%)negative, N (%)
Normal 5 (2.8) 174 (97.2) 5 (2.8) 174 (97.2) 179 (100) 
Premalignant 4 (3.3) 120 (96.7) 3 (2.4) 121 (97.6) 124 (100) 
Malignant 7 (11.4) 54 (88.6) 6 (9.8) 55 (90.2) 61 (100) 
Total 16 (4.4) 348 (95.6) 14 (3.8) 350 (96.2) 364 (100) 
Pathological stagesEBV genome
EBNA1 geneLMP1 genetotal, N (%)
positive, N (%)negative, N (%)positive, N (%)negative, N (%)
Normal 5 (2.8) 174 (97.2) 5 (2.8) 174 (97.2) 179 (100) 
Premalignant 4 (3.3) 120 (96.7) 3 (2.4) 121 (97.6) 124 (100) 
Malignant 7 (11.4) 54 (88.6) 6 (9.8) 55 (90.2) 61 (100) 
Total 16 (4.4) 348 (95.6) 14 (3.8) 350 (96.2) 364 (100) 

A statistically significant difference was found as the frequency of EBV was higher among patients with cervical cancer than premalignant and normal groups (p = 0.028) (Table 2). The odds ratio (OR) was estimated to be 1.15 and 3.8 among premalignant and malignant groups in comparison to the normal group, respectively. However, the prevalence of EBV was 10% in squamous cell carcinoma and 9.1% in adenocarcinoma cases, and no significant differences were observed between the prevalence of EBV and cancer types in women with cervical cancer (p = 0.99; OR = 1.1). Interestingly, while no statistically significant differences were observed between the frequency of EBV and sample types (p = 0.3; OR = 1.68), the EBV genome was detected higher in FFPE specimens (5.2%) compared to Thin-Prep Pap Test specimens (3.3%) (Table 2).

Table 2.

The frequency of Epstein-Barr virus (EBV) DNA by both EBNA1 and LMP1 genes in cervical samples, stratified by several factors

VariablesEBV genomep valueOR (95% CI)
positive, N (%)negative, N (%)total, N (%)
Total 14 (3.8) 350 (96.2) 364 (100)   
Pathological stages 
 Normal 5 (2.8) 174 (97.2) 179 (100)  
 Premalignant 3 (2.4) 121 (97.6) 124 (100) 0.028 1.15 (0.27–4.9) 
 Malignant 6 (9.8) 55 (90.2) 61 (100)  3.8 (1.1–12.9) 
 Total 14 (3.8) 350 (96.2) 364 (100)   
Cancer types 
 ADC 1 (9.1) 10 (90.9) 11 (100)  
 SCC 5 (10.0) 45 (90.0) 50 (100) 0.99 1.1 (0.11–10.5) 
Total 6 (9.8) 54 (90.2) 61 (100)   
Sample types 
 Thin-prep 8 (3.3) 242 (96.7) 250 (100)  
 FFPE 6 (5.2) 108 (94.8) 114 (100) 0.3 1.68 (0.5–4.9) 
Total 14 (3.8) 350 (96.2) 364 (100)   
HPV infection 
 Negative 1 (1.3) 73 (98.7) 74 (100)  
 Positive 13 (4.4) 277 (95.6) 290 (100) 0.36 3.4 (0.4–26.6) 
Total 14 (3.8) 350 (96.2) 364 (100)   
HPV genotypes 
 High-risk HPVs (non-16/18) 5 (2.9) 164 (97.1) 169 (100)  
 HPV 16/18 8 (6.6) 113 (93.4) 121 (100) 0.23 2.3 (0.7–7.2) 
Total 13 (4.5) 277 (95.5) 290 (100)   
Age group      
 20–30 2 (3.4) 57 (96.6) 59 (100)  
 30–40 2 (2.7) 72 (97.3) 74 (100)  0.7 (0.1–5.7) 
 40–50 1 (2.1) 46 (97.9) 47 (100) 0.088 0.6 (0.05–7) 
 >50 6 (11.1) 48 (88.9) 54 (100)  3.5 (0.6–18) 
Total 11 (4.7) 223 (95.3) 234 (100)   
Age group (<50 vs. >50)      
 ≤50 5 (2.8) 175 (97.2) 180 (100)  1 
 >50 6 (11.1) 48 (88.9) 54 (100) 0.041 4.3 (1.3–14.9) 
Total 11 (4.7) 223 (95.3) 234 (100)   
VariablesEBV genomep valueOR (95% CI)
positive, N (%)negative, N (%)total, N (%)
Total 14 (3.8) 350 (96.2) 364 (100)   
Pathological stages 
 Normal 5 (2.8) 174 (97.2) 179 (100)  
 Premalignant 3 (2.4) 121 (97.6) 124 (100) 0.028 1.15 (0.27–4.9) 
 Malignant 6 (9.8) 55 (90.2) 61 (100)  3.8 (1.1–12.9) 
 Total 14 (3.8) 350 (96.2) 364 (100)   
Cancer types 
 ADC 1 (9.1) 10 (90.9) 11 (100)  
 SCC 5 (10.0) 45 (90.0) 50 (100) 0.99 1.1 (0.11–10.5) 
Total 6 (9.8) 54 (90.2) 61 (100)   
Sample types 
 Thin-prep 8 (3.3) 242 (96.7) 250 (100)  
 FFPE 6 (5.2) 108 (94.8) 114 (100) 0.3 1.68 (0.5–4.9) 
Total 14 (3.8) 350 (96.2) 364 (100)   
HPV infection 
 Negative 1 (1.3) 73 (98.7) 74 (100)  
 Positive 13 (4.4) 277 (95.6) 290 (100) 0.36 3.4 (0.4–26.6) 
Total 14 (3.8) 350 (96.2) 364 (100)   
HPV genotypes 
 High-risk HPVs (non-16/18) 5 (2.9) 164 (97.1) 169 (100)  
 HPV 16/18 8 (6.6) 113 (93.4) 121 (100) 0.23 2.3 (0.7–7.2) 
Total 13 (4.5) 277 (95.5) 290 (100)   
Age group      
 20–30 2 (3.4) 57 (96.6) 59 (100)  
 30–40 2 (2.7) 72 (97.3) 74 (100)  0.7 (0.1–5.7) 
 40–50 1 (2.1) 46 (97.9) 47 (100) 0.088 0.6 (0.05–7) 
 >50 6 (11.1) 48 (88.9) 54 (100)  3.5 (0.6–18) 
Total 11 (4.7) 223 (95.3) 234 (100)   
Age group (<50 vs. >50)      
 ≤50 5 (2.8) 175 (97.2) 180 (100)  1 
 >50 6 (11.1) 48 (88.9) 54 (100) 0.041 4.3 (1.3–14.9) 
Total 11 (4.7) 223 (95.3) 234 (100)   

SCC, squamous cell carcinoma; ADC, adenocarcinoma; FFPE, formalin-fixed paraffin-embedded tissue; CI, confidence interval.

Although the EBV genome was more prevalent in HPV-positive than HPV-negative samples, the difference did not reach a statistically significant level (p = 0.36; OR = 3.4) (Table 2). As shown in Figure 1, the overall frequency of co-presence EBV and HPV was shown to be 3.6%. The genome of EBV was also detected in 0.27% of HPV-negative samples. The prevalence of EBV/HPV coinfection was 9.8%, 2.4%, and 2.2% in malignant, premalignant, and normal samples, respectively (Fig. 1).

Fig. 1.

Frequency of EBV and HPV DNAs in malignant, premalignant, and normal groups.

Fig. 1.

Frequency of EBV and HPV DNAs in malignant, premalignant, and normal groups.

Close modal

Regarding HPV genotypes, the total prevalence of EBV was 6.6% and 2.9% in samples that were co-infected with HPV 16/18 and other high-risk types, respectively (Table 2). Although the EBV prevalence was more common among women co-infected with HPV 16/18, a statistically significant difference was not found between HPV genotypes and EBV prevalence (p = 0.23; OR = 2.3).

As indicated in Table 2, the frequency of EBV was higher among women more than 50 years old (11.1%) compared to other age groups (3.4%, 2.7%, and 2.1% in age groups 20–30, 30–40, and 40–50 years old, respectively). However, no statistically significant differences were observed (p = 0.088). However, when we divided age groups into two age groups <50 and >50 years old, a significant difference was found as the EBV genome was found in 2.8% and 11.1% of age groups <50 and >50 years old, respectively (p = 0.041; OR = 4.3).

In this study, the prevalence of EBV was investigated in malignant, premalignant, and normal cervical specimens. The EBV genome was found in 11.1%, 2.5%, and 2.8% of malignant, premalignant, and normal specimens, respectively. A statistically significant difference was shown as the frequency of EBV was higher among patients with cervical cancer than premalignant and normal groups (p = 0.028). Consistent with our findings, several studies detected a higher prevalence of EBV in cancer than in normal cervical samples. In one study from Thailand, the EBV genome was found in 13.4% of normal cervical samples, 29.4% of low-grade squamous intraepithelial lesions (LSILs), 49.4% of high-grade squamous intraepithelial lesions (HSIL), and 35% of cervical cancer samples [23]. In a study from Brazil, the EBV genome was detected in 8.99%, 21.2%, and 64.3% of normal, premalignant, and malignant cervical samples, respectively [29]. In a study from Portugal, the EBV genome was found in 16.7% of normal samples, 9.5% of cervical intraepithelial neoplasia (CIN 1), 4.5% of CIN 2/3, and 22.2% of cervical cancer [22]. In Tunisia, the EBV genome was shown in 9.6% of nonmalignant samples and 29.5% of malignant samples of cervix [30]. Finally, in a meta-analysis study, the highest pooled prevalence was found in the cervical cancer group (43.6%) and in other studied groups, the pooled EBV prevalence was 34.6% for CIN 2/3, 27.3% for CIN 1, and 19% for normal groups [13]. However, few studies detected the EBV genome in premalignant and malignant cervical samples [31].

Overall, the prevalence of co-presence of EBV and HPV was found to be 4.4% while EBV was detected in 1.3% of HPV-negative samples. An important correlation between EBV and HPV coinfection and the incidence of high-grade cervical intraepithelial neoplasia (CIN2) was found in HIV-positive Chinese women. RNA sequencing showed that coinfection of EBV/HPV led to substantial changes in the gene expression, such as CACNG4, which was confirmed to be upregulated at both the mRNA and protein levels [32].

Our findings also indicated that the prevalence of EBV was more common among women co-infected with HPV 16/18 (6.6%) than co-infected with high-risk HPVs (non-16/18) (2.9%) (p = 0.23, Table 2). In agreement with this finding, a previous study showed that EBV DNA was detected more commonly in cervical cancer than in LSIL or HSIL among women infected with HPV 16 [33]. It is suggested that coinfection with one or more herpesviruses (particularly CMV or EBV) may enhance the genome integration of HPV (especially HPV 16) and be responsible for the development of cervical cancer. Indeed, Kahla et al. [30] found that EBV is more commonly present in samples with integrated or mixed (episomal and integrated) than episomal forms of HPV 16 as the likelihood of detecting integrated or mixed HPV 16 genome was shown to be sevenfold higher than episomal forms of HPV 16.

It is suggested that EBV infection can contribute to cervical carcinogenesis through several mechanisms. EBV potentially contributes to the development of cervical cancer in EBV-HPV co-infected lesions due to the induction of cellular abnormalities. Indeed, EBV LMP1 protein together with HPV 16 E6 protein decreases components of DNA damage response such as p53 and p27 leading to damage and genomic instability, while increasing checkpoint kinase 1, NF-kB signaling, Akt, and MAPK signaling in transformed mouse embryonic fibroblasts [24, 34]. Moreover, BARF1 and LMP1 can promote immune evasion and chronic inflammation in the tumor environment, respectively [33, 35]. HPV+/EBV+ cervical cancer also shows higher methylation of RB1 and E-cadherin (CDH1) gene promoters than HPV+/EBV– tumors [36]. According to the fact that all of the aforementioned functions are the hallmarks of cancer [37], EBV may play an important role in cooperating with HPV in cervical carcinogenesis. In this regard, two different mechanisms were supposed for EBV to promote cervical cancer including, 1-EBV probably has a synergistic effect with HPV in infecting epithelial cells; 2-EBV generates local immunosuppression in infecting tissue-infiltrating lymphocytes [38, 39].

EBV genome was found in 2.8% and 11.1% of age groups <50 and >50 years old, respectively. Whereas most EBV-positive cases were in the <50 years old among normal and premalignant samples, it was in the >50 years old group among malignant samples (71.4%). These findings are reasonable as the most cervical cancer incidence rate is reported among 55–65 year-old women in Iran [40]. This fact that more reactivation of herpesviruses happens with increasing age [41, 42], and it is also possible EBV is reactivated more frequently in women with cervical cancer due to aging-associated immunosuppression. The main limitation of this study is the small sample size, particularly in the malignant group.

Our findings showed that EBV could play an important role as a cofactor in the progression of cervical cancer. Furthermore, our result supports the likelihood of EBV transmission through cervical secretions. However, future studies with larger sample sizes and the expression analysis of EBV transcripts or proteins are mandatory.

Our research was conducted ethically by the World Medical Association Declaration of Helsinki. We declare that all participants sign informed consent to the study which was approved by the Local Research Ethics Committee of Tehran University of Medical Sciences (IR.TUMS.SPH.REC.1399.298).

The authors declare that they have no conflict of interest.

This study has been funded and supported by Tehran University of Medical Sciences (TUMS), Grant No. 50935. It has also been part of a MSc thesis supported by Tehran University of Medical Sciences, Grant No. 240/928.

Z.S. and S.J. have contributed to the design of the study; S.C. has done all tests; Z.S. has contributed to the analysis and interpretation of data; S.J. has contributed to drafting the article.

Data are not publicly available due to ethical reasons. Further inquiries can be directed to the corresponding author.

1.
International Agency for Research on Cancer
GLOBOCAN 2020: estimated cancer incidence, mortality and prevalence worldwide in 2020
.
2020
.
2.
Sung
H
,
Ferlay
J
,
Siegel
RL
,
Laversanne
M
,
Soerjomataram
I
,
Jemal
A
, et al
.
Global cancer statistics 2020: GLOBOCAN estimates of incidence and mortality worldwide for 36 cancers in 185 countries
.
CA Cancer J Clin
.
2021
;
71
(
3
):
209
49
.
3.
National report of the National Cancer Registry Program in Iran
.
2017
.
4.
Bouvard
V
,
Baan
R
,
Straif
K
,
Grosse
Y
,
Secretan
B
,
El Ghissassi
F
, et al
.
A review of human carcinogens--Part B: biological agents
.
Lancet Oncol
.
2009 4/2009
;
10
(
4
):
321
2
.
5.
Doorbar
J
,
Quint
W
,
Banks
L
,
Bravo
IG
,
Stoler
M
,
Broker
TR
, et al
.
The biology and life-cycle of human papillomaviruses
.
Vaccine
.
2012
;
30
(
Suppl 5
):
F55
70
.
6.
Munoz
N
,
Bosch
FX
,
de Sanjosé
S
,
Herrero
R
,
Castellsague
X
,
Shah
KV
, et al
.
Epidemiologic classification of human papillomavirus types associated with cervical cancer
.
N Engl J Med
.
2003
;
348
(
6
):
518
27
.
7.
Li
N
,
Franceschi
S
,
Howell-Jones
R
,
Snijders
PJ
,
Clifford
GM
.
Human papillomavirus type distribution in 30,848 invasive cervical cancers worldwide: variation by geographical region, histological type and year of publication
.
Int J Cancer
.
2011
;
128
(
4
):
927
35
.
8.
Tota
JE
,
Chevarie-Davis
M
,
Richardson
LA
,
Devries
M
,
Franco
EL
.
Epidemiology and burden of HPV infection and related diseases: implications for prevention strategies
.
Prev Med
.
2011
;
53
(
Suppl 1
):
S12
21
.
9.
Moscicki
AB
,
Schiffman
M
,
Burchell
A
,
Albero
G
,
Giuliano
AR
,
Goodman
MT
, et al
.
Updating the natural history of human papillomavirus and anogenital cancers
.
Vaccine
.
2012
;
30 Suppl 5
(
0 5
):
F24
33
.
10.
de Sanjosé
S
,
Brotons
M
,
Pavón
MA
.
The natural history of human papillomavirus infection
.
Best Pract Res Clin Obstet Gynaecol
.
2018
;
47
:
2
13
.
11.
Koskela
P
,
Anttila
T
,
Bjørge
T
,
Brunsvig
A
,
Dillner
J
,
Hakama
M
, et al
.
Chlamydia trachomatis infection as a risk factor for invasive cervical cancer
.
Int J Cancer
.
2000
;
85
(
1
):
35
9
.
12.
Silva
J
,
Cerqueira
F
,
Medeiros
R
.
Chlamydia trachomatis infection: implications for HPV status and cervical cancer
.
Arch Gynecol Obstet
.
2014
;
289
(
4
):
715
23
.
13.
de Lima
MAP
,
Neto
PJN
,
Lima
LPM
,
Gonçalves Júnior
J
,
Teixeira Junior
AG
,
Teodoro
IPP
, et al
.
Association between Epstein-Barr virus (EBV) and cervical carcinoma: a meta-analysis
.
Gynecol Oncol
.
2018
;
148
(
2
):
317
28
.
14.
Kelly
H
,
Weiss
HA
,
Benavente
Y
,
de Sanjose
S
,
Mayaud
P
;
ART and HPV Review Group
.
Association of antiretroviral therapy with high-risk human papillomavirus, cervical intraepithelial neoplasia, and invasive cervical cancer in women living with HIV: a systematic review and meta-analysis
.
Lancet HIV
.
2018
;
5
(
1
):
e45
58
.
15.
Kovachev
SM
.
Cervical cancer and vaginal microbiota changes
.
Arch Microbiol
.
2020
;
202
(
2
):
323
7
.
16.
Kapranos
N
,
Petrakou
E
,
Anastasiadou
C
,
Kotronias
D
.
Detection of herpes simplex virus, cytomegalovirus, and Epstein-Barr virus in the semen of men attending an infertility clinic
.
Fertil Steril
.
2003
;
79
(
Suppl 3
):
1566
70
.
17.
Cohen
JI
.
Epstein-Barr virus infection
.
N Engl J Med
.
2000
;
343
(
7
):
481
92
.
18.
Crawford
DH
,
Swerdlow
AJ
,
Higgins
C
,
McAulay
K
,
Harrison
N
,
Williams
H
, et al
.
Sexual history and epstein-barr virus infection
.
J Infect Dis
.
2002
;
186
(
6
):
731
6
.
19.
Nowalk
A
,
Green
M
.
Epstein-Barr virus
.
Microbiol Spectr
.
2016
;
4
(
3
).
20.
Wong
SY
,
Sewell
HF
,
MacGregor
JE
,
Walker
F
.
Epstein-Barr virus--a possible missing link in the initiation of cervical carcinogenesis
.
Med Hypotheses
.
1991
;
35
(
3
):
219
22
.
21.
Seo
SS
,
Kim
WH
,
Song
YS
,
Kim
SH
,
Kim
JW
,
Park
NH
, et al
.
Epstein-Barr virus plays little role in cervical carcinogenesis in Korean women
.
Int J Gynecol Cancer
.
2005
;
15
(
2
):
312
8
.
22.
Marinho-Dias
J
,
Ribeiro
J
,
Monteiro
P
,
Loureiro
J
,
Baldaque
I
,
Medeiros
R
, et al
.
Characterization of cytomegalovirus and epstein-barr virus infection in cervical lesions in Portugal
.
J Med Virol
.
2013
;
85
(
8
):
1409
13
.
23.
Aromseree
S
,
Pientong
C
,
Swangphon
P
,
Chaiwongkot
A
,
Patarapadungkit
N
,
Kleebkaow
P
, et al
.
Possible contributing role of Epstein-Barr virus (EBV) as a cofactor in human papillomavirus (HPV)-associated cervical carcinogenesis
.
J Clin Virol
.
2015
;
73
:
70
6
.
24.
Shimabuku
T
,
Tamanaha
A
,
Kitamura
B
,
Tanabe
Y
,
Tawata
N
,
Ikehara
F
, et al
.
Dual expression of Epstein-Barr virus, latent membrane protein-1 and human papillomavirus-16 E6 transform primary mouse embryonic fibroblasts through NF-κB signaling
.
Int J Clin Exp Pathol
.
2014
;
7
(
5
):
1920
34
.
25.
Joharinia
N
,
Faghihinejad
S
,
Seyedi
K
,
Farhadi
A
,
Hosseini
SY
,
Safaei
A
, et al
.
Co-Existing of HSV1/2 or EBV infection with the presence of high-risk HPV DNA in cervical lesions in the southwest of Iran
.
Asian Pac J Cancer Prev
.
2020
;
21
(
5
):
1459
64
.
26.
Jalilvand
S
,
Tornesello
ML
,
Buonaguro
FM
,
Buonaguro
L
,
Naraghi
ZS
,
Shoja
Z
, et al
.
Molecular epidemiology of human herpesvirus 8 variants in Kaposi’s sarcoma from Iranian patients
.
Virus Res
.
2012 2/2012
;
163
(
2
):
644
9
.
27.
Sato
Y
,
Sugie
R
,
Tsuchiya
B
,
Kameya
T
,
Natori
M
,
Mukai
K
.
Comparison of the DNA extraction methods for polymerase chain reaction amplification from formalin-fixed and paraffin-embedded tissues
.
Diagn Mol Pathol
.
2001
;
10
(
4
):
265
71
.
28.
Heydari
N
,
Oskouee
MA
,
Vaezi
T
,
Shoja
Z
,
Esmaeili
HA
,
Hamkar
R
, et al
.
Type‐specific human papillomavirus prevalence in cervical intraepithelial neoplasia and cancer in Iran
.
J Med Virol
.
2018
;
90
(
1
):
172
6
.
29.
Santos
NBM
,
Villanova
FE
,
Andrade
PM
,
Ribalta
J
,
Focchi
J
,
Otsuka
AY
, et al
.
Epstein-Barr virus detection in invasive and pre-invasive lesions of the uterine cervix
.
Oncol Rep
.
2009
;
21
(
2
):
403
5
.
30.
Kahla
S
,
Oueslati
S
,
Achour
M
,
Kochbati
L
,
Chanoufi
MB
,
Maalej
M
, et al
.
Correlation between ebv co-infection and HPV16 genome integrity in Tunisian cervical cancer patients
.
Braz J Microbiol
.
2012
;
43
(
2
):
744
53
.
31.
Hilton
DA
,
Brown
LJR
,
Pringle
JH
,
Nandha
H
.
Absence of epstein – barr virus in carcinoma of the cervix
.
Cancer
.
1993
;
72
(
6
):
1946
8
.
32.
Feng
M
,
Duan
R
,
Gao
Y
,
Zhang
H
,
Qiao
Y
,
Li
Q
, et al
.
Role of epstein-barr virus and human papillomavirus coinfection in cervical intraepithelial neoplasia in Chinese women living with HIV
.
Front Cell Infect Microbiol
.
2021
;
11
:
703259
.
33.
Szostek
S
,
Zawilinska
B
,
Kopec
J
,
Kosz-Vnenchak
M
.
Herpesviruses as possible cofactors in HPV-16-related oncogenesis
.
Acta Biochim Pol
.
2009
;
56
(
2
):
337
42
.
34.
Wang
LW
,
Jiang
S
,
Gewurz
BE
.
Epstein-Barr virus LMP1-mediated oncogenicity
.
J Virol
.
2017
;
91
(
21
):
e01718–16
.
35.
Al-Thawadi
H
,
Ghabreau
L
,
Aboulkassim
T
,
Yasmeen
A
,
Vranic
S
,
Batist
G
, et al
.
Co-incidence of epstein-barr virus and high-risk human papillomaviruses in cervical cancer of Syrian women
.
Front Oncol
.
2018
;
8
:
250
0
.
36.
McCormick
TM
,
Canedo
NH
,
Furtado
YL
,
Silveira
FA
,
de Lima
RJ
,
Rosman
AD
, et al
.
Association between human papillomavirus and Epstein: barr virus DNA and gene promoter methylation of RB1 and CDH1 in the cervical lesions: a transversal study
.
Diagn Pathol
.
2015
;
10
:
59
.
37.
Hanahan
D
,
Weinberg
RA
.
Hallmarks of cancer: the next generation
.
Cell
.
2011
;
144
(
5
):
646
74
.
38.
Guidry
JT
,
Scott
RS
.
The interaction between human papillomavirus and other viruses
.
Virus Res
.
2017
;
231
:
139
47
.
39.
Blanco
R
,
Carrillo-Beltrán
D
,
Osorio
JC
,
Calaf
GM
,
Aguayo
F
.
Role of epstein-barr virus and human papillomavirus coinfection in cervical cancer: epidemiology, mechanisms and perspectives
.
Pathogens
.
2020
;
9
(
9
):
685
.
40.
Khorasanizadeh
F
,
Hassanloo
J
,
Khaksar
N
,
Mohammad Taheri
S
,
Marzaban
M
,
H Rashidi
B
, et al
.
Epidemiology of cervical cancer and human papilloma virus infection among Iranian women: analyses of national data and systematic review of the literature
.
Gynecol Oncol
.
2013
;
128
(
2
):
277
81
.
41.
Stowe
RP
,
Kozlova
EV
,
Yetman
DL
,
Walling
DM
,
Goodwin
JS
,
Glaser
R
.
Chronic herpesvirus reactivation occurs in aging
.
Exp Gerontol
.
2007
;
42
(
6
):
563
70
.
42.
Thomasini
RL
,
Pereira
DS
,
Pereira
FSM
,
Mateo
EC
,
Mota
TN
,
Guimarães
GG
, et al
.
Aged-associated cytomegalovirus and Epstein-Barr virus reactivation and cytomegalovirus relationship with the frailty syndrome in older women
.
PLoS One
.
2017
;
12
(
7
):
e0180841
.