Background/Aims: Hepatitis C virus (HCV) core protein can induce liver steatosis and glucose intolerance in transgenic mice. We aimed to clarify the association of HCV core region heterogeneity with the development of insulin resistance (IR) among patients with chronic hepatitis C (CHC). Methods: A total of 56 non-diabetic CHC genotype-1b patients were enrolled. IR was evaluated by the homeostasis model assessment (HOMA). The amino acid (aa) sequences in the core region were determined by polymerase chain reaction and direct sequencing. Results: Patients with a higher HOMA-IR (≥3.5) had a higher ratio of aa substitutions in core 70 (p = 0.025), a higher body mass index (p = 0.021) and serum total cholesterol level (p = 0.044) and presence of hepatic steatosis (≥5%) as compared with those with a lower HOMA-IR (<3.5). Multivariate analysis showed that independent factors of higher HOMA-IR were mutated aa70 (odds ratio 3.80, p = 0.033) and body mass index (odds ratio 1.20, p = 0.042). Patients with mutated aa70 had a higher serum tumor necrosis factor-α level than those with wild-type (p = 0.014). Conclusions: Substitution of the HCV-1b core region at position 70 was an independent factor associated with developing IR among patients with CHC.

Hepatitis C virus (HCV) infection is a serious health problem affecting millions of people across all populations worldwide [1]. Most acutely infected patients develop chronic hepatitis and as many as 20% of patients will develop cirrhosis and its complications over two or more decades [2,3,4]. Although the target of HCV is the liver, metabolic abnormalities are common in patients with chronic HCV infection [5,6,7,8,9]. There is considerable evidence that patients with chronic hepatitis C (CHC) are at a greater risk of developing insulin resistance (IR) and, ultimately, type 2 diabetes mellitus (DM) compared with non-infected individuals or those with hepatitis B virus infection [5,6,7,8,9,10,11].

The development of IR and type 2 DM involves highly complex systemic mechanisms. Chronic HCV infection promotes IR mainly through interfering with the insulin signaling pathway in hepatocytes, increasing the inflammatory response with cytokine production such as tumor necrosis factor (TNF)-α and interleukin (IL)-6, and increasing oxidative stress [11]. HCV transgenic mice can exhibit IR as early as 1 month of age, despite an apparent absence of glucose intolerance, hepatic steatosis and liver injury [10]. Other studies have demonstrated the existence of a dose-response relationship between HCV viral load and the degree of IR [12,13]. These data, taken together, have clearly indicated that infection of HCV per se is a cause of the development of IR.

Previous studies reported that HCV core protein induced hepatocellular carcinoma (HCC) and IR in transgenic mice, and provided direct experimental evidence for the contribution of HCV core protein in the development of HCC and IR in human HCV infection [10,14,15,16]. It is thought that HCV infection causes direct damage through the action of the core proteins, which induces an inflammatory state characterized by secretion of proinflammatory cytokines that interfere with normal insulin signaling and disturb glucose metabolism [15]. Recently, Akuta et al. [17] reported that amino acid (aa) substitutions of the core region at position 70 and/or 91 were the important predictors of severe IR in patients without cirrhosis and DM. Moreover, several host factors, such as metabolic syndrome, obesity and a high body mass index (BMI), also have an influence on IR in CHC patients [9,18]. In this study, we aimed to investigate whether HCV core region heterogeneity had an independent impact on the development of IR among Taiwanese patients with CHC.

Patients

A total of 56 non-diabetic patients attending our outpatient clinic, who were chronically infected with HCV genotype-1b, were enrolled in the study. All patients had positive anti-HCV antibody (Ax SYM HCV 3.0; Abbott Laboratories, Chicago, Ill., USA), detectable HCV RNA (Amplicor™; Roche Diagnostics, Branchburg, N.J., USA) in serum, and elevated alanine aminotransferase values for at least 6 months. Exclusion criteria included concomitant hepatitis B virus or human immunodeficiency virus infection, alcoholism, autoimmune hepatitis, and a previous history of interferon-based therapy. The study protocol, which conforms to the provisions of the Declaration of Helsinki, was approved beforehand by the human research and ethics committee (institutional review board), and written informed consent was obtained from each patient.

Pathologic diagnosis was performed by percutaneous liver biopsies (n = 45), which were analyzed by pathologists unaware of the patients' characteristics. Hepatic inflammation and fibrosis were assessed according to the modified Knodell histologic activity index (HAI) [19]. Steatosis was graded into follows: <5 or ≥5% involving hepatocytes with steatosis.

Qualitative and Quantitative Measurement of HCV RNA and HCV Genotyping

Serum was prepared in a laminar flow bench and frozen at -70°. Qualitative detection of HCV RNA was performed by a standardized qualitative reverse transcription-polymerase chain reaction (RT-PCR) assay (Amplicor; Roche Diagnostics), using biotinylated primers for the 5′ non-coding region. The lowest detection of the assay was 100 copies/ml. Serum HCV RNA levels were determined by a branched-DNA (b-DNA) signal amplification assay (Versant HCV RNA 3.0. Assay; Bayer Diagnostics, Emeryville, Calif., USA). This assay was a sandwich nucleic-acid hybridization procedure with a detectable limit at 3,400 copies/ml. Genotyping of HCV was done by reverse hybridization assay (Inno-LiPA™ HCV II; Innogenetics NV, Gent, Belgium) in the HCV-Amplicor products.

Amplification of the Core Region by RT-PCR and Sequence Analysis

RNA was extracted from 140 µl of serum by QIAamp® RNA Mini Kits (Qiagen, Inc., Hilden, Germany). One tenth of extracted RNA was subjected to nested RT-PCR. Core fragments were amplified with the 5′ GGCCTTGTGGTACTGCCTGAT; nt 278-298); 3′ ATGTACCCCATGAGGTCGGC; nt 732-751). All amplifications were performed for 40 cycles (1 min at 94°, 1 min at 55°, 1 min at 72°) and the nested PCR products were sequenced directly using an ABI Prism 377 automated DNA sequencer and DNA dye terminator cycle sequencing kit (PerkinElmer, Oak Brook, Ill., USA).

Laboratory Assessments

Stored serum samples were collected after 12 h of overnight fasting from each individual and were stored at the -70° until test. Plasma glucose, total cholesterol and triglyceride were measured with enzymatic methods by autoanalyzer. Plasma insulin was measured by radioimmunoassay (Coat-A-Count insulin kit; Diagnostic Products Corp., Los Angeles, Calif., USA). IR was calculated by the homeostasis model (HOMA-IR) using the following formula: HOMA-IR = fasting insulin (µU/ml) × plasma glucose (mmol/l) × 22.5.

Circulating plasma levels of TNF-α were measured in duplicate by sandwich ELISA using commercial kits according to the manufacturer's instructions (Quantikine ELISA Kits; R&D Systems, Inc., Minneapolis, Minn., USA). The differences between duplicate wells were consistently less than 10% of the mean values. The mean values of duplicate measurements were used in the analyses.

Statistical Analysis

Continuous data are expressed as mean ± SD, and the categorical data are expressed as numbers (percentages). Comparisons of differences in the categorical data between groups were performed using the χ2 test or Fisher's exact test. Distributions of continuous variables were analyzed by Student's t test or the Mann-Whitney U test for the two groups where appropriate. Multiple logistic regression analysis with stepwise variable selection was performed to assess the independent factors of higher HOMA-IR (≥3.5). All analyses were carried out using SPSS software version 15.0 (SPSS, Inc., Chicago, Ill., USA). All tests were two-tailed, and p < 0.05 was considered statistically significant.

Patient Characteristics

The baseline characteristics of the 56 non-diabetic patients with CHC genotype-1 are shown in table 1. There were 28 men and 28 women, with a mean age of 52.7 ± 10.2 years. Obvious hepatic steatosis (≥5%) in liver tissue was present in 14 (31%) of the patients. Fibrosis was absent in 4 (9%), stage 1 or 2 in 22 (49%), and stage 3 or 4 in 19 (42%).

Table 1

Baseline characteristics of 56 non-diabetic patients with CHC genotype-1

Baseline characteristics of 56 non-diabetic patients with CHC genotype-1
Baseline characteristics of 56 non-diabetic patients with CHC genotype-1

Substitutions of aa70 (arginine) in the core region were found in 20 (38%) of the patients, including 17 glutamine, 2 histidine, and 1 proline. Substitutions of aa91 (leucine) were found in 11 (20%) of the patients, including 8 methionine and 3 cysteine.

Factors Associated with a Higher HOMA-IR

As shown in table 2, patients with a higher HOMA-IR (≥3.5) had a higher BMI (p = 0.021), serum total cholesterol level (p = 0.044), and presence of hepatic steatosis (≥5%) as compared with those with a lower HOMA-IR (<3.5). In addition, patients with a higher HOMA-IR had a higher ratio of aa substitutions in core 70 (p = 0.025). There was no significance with respect to age, sex, serum triglyceride and GPT level, aa substitutions in core 91 and HAI or fibrosis score between the two groups. Figure 1 shows the correlation between HCV load (copies/ml) and HOMA-IR (r = 0.490, p = 0.003) in 34 cases with available data. However, there was no association of HCV load with a higher HOMA-IR.

Table 2

Comparison between patients with higher and lower HOMA-IR

Comparison between patients with higher and lower HOMA-IR
Comparison between patients with higher and lower HOMA-IR
Fig. 1

Correlation between HCV load (copies/ml) and HOMA-IR (r = 0.490, p = 0.003).

Fig. 1

Correlation between HCV load (copies/ml) and HOMA-IR (r = 0.490, p = 0.003).

Close modal

Stepwise multiple logistic regression analysis of the factors with complete data including age, gender, BMI, serum cholesterol level and aa substitutions of core 70 and 91 revealed that independent factors of a higher HOMA-IR (≥3.5) were mutated aa70 (odds ratio (OR) 3.80, 95% confidence interval (CI) 1.11-12.99, p = 0.033) and BMI (OR 1.20, 95% CI 1.01-1.44, p = 0.042) (table 3).

Table 3

Stepwise logistic regression analysis of factors associated with a higher HOMA-IR (≥3.5)

Stepwise logistic regression analysis of factors associated with a higher HOMA-IR (≥3.5)
Stepwise logistic regression analysis of factors associated with a higher HOMA-IR (≥3.5)

Comparison between Patients with and without aa Substitutions in Core 70

Serum TNF-α levels were available in 38 of 56 patients. Patients with a higher HOMA-IR had higher serum TNF-α levels than those with a lower HOMA-IR (table 2). As shown in figure 2, patients with aa substitutions in core 70 had a higher serum TNF-α level compared to those without (2.3 ± 0.9 vs. 1.7 ± 0.7 pg/ml, p = 0.014). There was no significant difference with regard to age, sex, BMI, serum total cholesterol and triglyceride level, presence of hepatic steatosis and HAI or fibrosis score between these two groups.

Fig. 2

Comparison of serum TNF-α level between patients with and without aa substitutions in core 70 (p = 0.014).

Fig. 2

Comparison of serum TNF-α level between patients with and without aa substitutions in core 70 (p = 0.014).

Close modal

HCV core protein is a structural protein that modulates cellular processes, gene transcription, cell proliferation, and interacts with apoptotic pathways, which lead to the induction of apoptosis or rendering cells resistant to pro-apoptotic signal [16,20,21,22]. Published data have implicated that HCV core protein causes lipid accumulation when expressed in cultured cell lines, data which now indicate a critical step for HCV replication, assembly and release [23]. Recent studies have demonstrated that HCV core protein can induce steatosis in the liver, and IR and glucose intolerance in transgenic mice without gain in body weight at young age [10]. These data indicate a direct involvement of HCV per se in the pathogenesis of DM in chronic HCV infection through core protein.

Previous studies have shown that aa substitutions at position 70 and/or 91 in the HCV core region were negative predictors of virological response to interferon-based therapies in Japanese patients [24,25]. It is worthwhile determining whether HCV core heterogeneity in these points correlates with the development of IR among patients with CHC, particularly because IR is also reported to be a predictor of poor virological response to interferon-based therapies [26,27]. In this study, we showed that factors associated with a higher HOMA-IR were a higher BMI, serum total cholesterol level, presence of hepatic steatosis and aa substitutions in core 70. By multiple logistic regression analysis, mutated aa70 (OR 3.80) and BMI (OR 1.20) were independent variables associated with a higher HOMA-IR. Unlike in another report [17], our results showed that age and aa substitutions in core 91 did not correlate with HOMA-IR. These discrepant data might be associated with our small sample size (e.g. possible type II error) and the different cohorts of patient collection.

In this study, we demonstrated that patients with a higher HOMA-IR had higher serum TNF-α levels than those with a lower HOMA-IR. These results support the fact that increased TNF-α levels may play a role in the HCV-induced IR [10]. Although it is not compatible with our earlier observations on the association between IR and serum TNF-α level, this can be explained by the different statistical method between these two studies [18]. Interestingly, patients with aa substitutions in core 70 had higher serum TNF-α levels compared to those without, suggesting that HCV core region heterogeneity is associated with the development of IR possibly through regulation of the secretion of TNF-α [28]. Our findings were in accordance with previous reports that HCV core protein can induce overexpression of TNF-α in the liver of transgenic mice and human hepatoma cell lines [29]. On the other hand, HCV core protein-induced upregulation of suppressor of cytokine signaling (SOCS)-3 results in inhibition of the signaling cascade by the increased proteosomal degradation of insulin receptor substrate 1 and insulin receptor substrate 2 [30]. Secondly, HCV core protein may play an important role in the regulation of cellular inflammatory and immune responses through the activation of nuclear factor ĸ-light-chain enhancer of activated B cells (NF-ĸB) [31,32]. Activation of NF-ĸB is involved in the initiation of downstream production of IL-6 that leads to IR [33,34]. Further studies that examine the structural and functional impact of aa substitutions in the core region should be conducted to confirm the above findings.

In conclusion, our data indicated that substitution of the HCV-1b core region at position 70 was an independent factor associated with the development of IR among patients with CHC, after adjusting for clinical and metabolic factors. TNF-α appears to play an important role that links core protein with IR in chronic HCV infection. However, the complex role of HCV core heterogeneity in the pathogenesis of IR merits further studies.

This study was supported by Grant CMRPG891311 from Chang Gung Memorial Hospital, Taiwan, ROC.

1.
World Health Organisation: Weekly epidemiological record. Wkly Epidemiol Rec 2002;77:41-48.
2.
Seeff LB, Buskell-Bales Z, Wright EC, et al: Long-term mortality after transfusion-associated non-A, non-B hepatitis. The National Heart, Lung, and Blood Institute Study Group. N Engl J Med 1992;327:1906-1911.
3.
Niederau C, Lange S, Heintges T, et al: Prognosis of chronic hepatitis C: results of a large, prospective cohort study. Hepatology 1998;28:1687-1695.
4.
Hung CH, Chen CH, Lee CM, et al: Association of amino acid variations in the NS5A and E2-PePHD region of hepatitis C virus 1b with hepatocellular carcinoma. J Viral Hepat 2008:15:58-65.
5.
Hadziyannis SJ: The spectrum of extrahepatic manifestations in hepatitis C virus infection. J Viral Hepat 1997;4:9-28.
6.
Kuo YH, Chuang TW, Hung CH, et al: Reversal of hypolipidemia in chronic hepatitis C patients after successful antiviral therapy. J Formos Med Assoc 2011;110:363-371.
7.
Huang JF, Dai CY, Hwang SJ, et al: Hepatitis C viremia increases the association with type 2 diabetes mellitus in a hepatitis B and C endemic area: an epidemiological link with virological implication. Am J Gastroenterol 2007;102:1237-1243.
8.
Petit JM, Bour JB, Galland-Jos C, et al: Risk factor for diabetes mellitus and early insulin resistance in chronic hepatitis C. J Hepatol 2001;35:279-283.
9.
Hui JM, Sud A, Farrell GC, et al: Insulin resistance is associated with chronic hepatitis C virus infection and fibrosis progression. Gastroenterology 2003;125:1695-1704.
10.
Shintani Y, Fujie H, Miyoshi H, et al: Hepatitis C virus infection and diabetes: direct involvement of the virus in the development of insulin resistance. Gastroenterology 2004;126:840-848.
11.
Hung CH, Lee CM, Lu SN: Hepatitis C virus-associated insulin resistance: pathogenic mechanisms and clinical implications. Expert Rev Anti Infect Ther 2011;9:525-533.
12.
Hsu CS, Liu CJ, Liu CH, et al: High hepatitis C viral load is associated with insulin resistance in patients with chronic hepatitis C. Liver Int 2008;28:271-277.
13.
Moucari R, Asselah T, Cazals-Hatem D, et al: Insulin resistance in chronic hepatitis C: association with genotypes 1 and 4, serum HCV RNA level, and liver fibrosis. Gastroenterology 2008;134:416-423.
14.
Moriya K, Yotsuyanagi H, Shintani Y, et al: Hepatitis C virus core protein induces hepatic steatosis in transgenic mice. J Gen Virol 1997;78:1527-1531.
15.
Gutiérrez-Grobe Y, Ponciano-Rodríguez G, Méndez-Sánchez N: Viral hepatitis infection and insulin resistance: a review of the pathophysiological mechanisms. Salud Publica Mex 2011;53(suppl 1):S46-51.
16.
Khaliq S, Jahan S, Pervaiz A: Sequence variability of HCV core region: important predictors of HCV-induced pathogenesis and viral production. Infect Genet Evol 2011;11:543-556.
17.
Akuta N, Suzuki F, Hirakawa M, et al: Amino acid substitutions in the hepatitis C virus core region of genotype 1b are the important predictor of severe insulin resistance in patients without cirrhosis and diabetes mellitus. J Med Virol 2009;81:1032-1039.
18.
Hung CH, Lee CM, Chen CH, et al: Association of inflammatory and anti-inflammatory cytokines with insulin resistance in chronic hepatitis C. Liver Int 2009;29:1086-1093.
19.
Desmet VJ, Gerber M, Hoofnagle JH, et al: Classification of chronic hepatitis: diagnosis, grading and staging. Hepatology 1994;19:1513-1520.
20.
Moriya K, Fujie H, Shintani Y, et al: The core protein of hepatitis C virus induces hepatocellular carcinoma in transgenic mice. Nat Med 1998;4:1065-1067.
21.
Honda M, Kaneko S, Shimazaki T, et al: Hepatitis C virus core protein induces apoptosis and impairs cell-cycle regulation in stably transformed Chinese hamster ovary cells. Hepatology 2000;31:1351-1359.
22.
Ray RB, Lagging LM, Meyer K, et al: Hepatitis C virus core protein cooperates with ras and transforms primary rat embryo fibroblasts to tumorigenic phenotype. J Virol 1996;70:4438-4443.
23.
Qiang G, Yang L, Witek RP, et al: Recombinant adenoviruses expressing steatosis-associated hepatitis C virus genotype 3 core protein produce intracellular lipid accumulation in cultured and primary hepatocytes. Virus Res 2009;139:127-130.
24.
Akuta N, Suzuki F, Sezaki H, et al: Predictive factors of virological non-response to interferon-ribavirin combination therapy for patients infected with hepatitis C virus of genotype 1b and high viral load. J Med Virol 2006;78:83-90.
25.
Akuta N, Suzuki F, Kawamura Y, et al: Predictors of viral kinetics to peginterferon plus ribavirin combination therapy in Japanese patients infected with hepatitis C virus genotype 1b. J Med Virol 2007;79:1686-1695.
26.
Dai CY, Huang JF, Hsieh MY, et al: Insulin resistance predicts response to peginterferon-α/ribavirin combination therapy in chronic hepatitis C patients. J Hepatol 2009;50:712-718.
27.
Romero-Gómez M, Del Mar Viloria M, Andrade RJ, et al: Insulin resistance impairs sustained response rate to peginterferon plus ribavirin in chronic hepatitis C patients. Gastroenterology 2005;128:636-641.
28.
Miyamoto H, Moriishi K, Moriya K, et al: Involvement of the PA28γ-dependent pathway in insulin resistance induced by hepatitis C virus core protein. J Virol 2007;81:1727-1735.
29.
Greenberg AS, McDaniel ML: Identifying the links between obesity, insulin resistance and β-cell function: potential role of adipocyte-derived cytokines in the pathogenesis of type 2 diabetes. Eur J Clin Invest 2002;32(suppl 3):24-34.
30.
Kawaguchi T, Yoshida T, Harada M, et al: Hepatitis C virus down-regulates insulin receptor substrates 1 and 2 through upregulation of suppressor of cytokine signaling 3. Am J Pathol 2004;165:1499-1508.
31.
Chung YM, Park KJ, Choi SY, et al: Hepatitis C virus core protein potentiates TNF-α-induced NF-ĸB activation through TRAF2-IKKβ-dependent pathway. Biochem Biophys Res Commun 2001;284:15-19.
32.
Yoshida H, Kato N, Shiratori Y, et al: Hepatitis C virus core protein activates nuclear factor-ĸB-dependent signaling through tumor necrosis factor receptor associated factor. J Biol Chem 2001;276:16399-16405.
33.
Arkan MC, Hevener AL, Greten FR, et al: IKK-β links inflammation to obesity-induced insulin resistance. Nat Med 2005;11:191-198.
34.
Cai D, Yuan M, Frantz DF, et al: Local and systemic insulin resistance resulting from hepatic activation of IKK-β and NF-ĸB. Nat Med 2005;11:183-190.
Copyright / Drug Dosage / Disclaimer
Copyright: All rights reserved. No part of this publication may be translated into other languages, reproduced or utilized in any form or by any means, electronic or mechanical, including photocopying, recording, microcopying, or by any information storage and retrieval system, without permission in writing from the publisher.
Drug Dosage: The authors and the publisher have exerted every effort to ensure that drug selection and dosage set forth in this text are in accord with current recommendations and practice at the time of publication. However, in view of ongoing research, changes in government regulations, and the constant flow of information relating to drug therapy and drug reactions, the reader is urged to check the package insert for each drug for any changes in indications and dosage and for added warnings and precautions. This is particularly important when the recommended agent is a new and/or infrequently employed drug.
Disclaimer: The statements, opinions and data contained in this publication are solely those of the individual authors and contributors and not of the publishers and the editor(s). The appearance of advertisements or/and product references in the publication is not a warranty, endorsement, or approval of the products or services advertised or of their effectiveness, quality or safety. The publisher and the editor(s) disclaim responsibility for any injury to persons or property resulting from any ideas, methods, instructions or products referred to in the content or advertisements.