... platelet biology. The activation of thrombocytes and subsequent clot formation are highly energetic processes being tied to mitochondrial activity, and the inhibition of the electron transport chain (ETC) impedes on thrombogenesis, suggesting the potential role of mitochondria in TIC. Our present study...

...- AGGCATCACCCCGCTAAATC, R- CCGTAGATGCCGTCGG-AAAT. The abundance of mtDNA was expressed as a threshold cycle (Tc) and as relative to the level before surgery. Of note, a higher Tc represents a lower level of mtDNA DAMPs. Mitochondria DAMPs SIRS Pancreatic surgery Abdominal surgery triggers...

... in the normal liver, which contributes to a low survival rate in rats with cirrhosis. Liver cirrhosis Adenosine triphosphate Mitochondria Oxygen radicals Xanthine Hypoxanthine Superoxide dismutase 8 05 1990 16 10 1990 23 4 2008 © 1991 S. Karger AG, Basel 1991 Copyright...

.... Platelet Energy charge Arterial ketone body ratio Hepatectomy Mitochondria Original Paper Eur Surg Res 1995;27:77-81 II. Egawaa M. Zaimaa K. Moria H. Hiroshia 5. Iwata* K. Ozawab Y. Yamaokaa 3 Second Department of Surgery, Faculty o f Medicine, Kyoto University, Kyoto; b Shiga University of Medical...

...Y. Yamamoto; M. Obara; W. Isselhard; J. Sturz; T. Morimoto; T. Minor; S. Saad; K. Ozawa In liver transplantation, graft viability is ideally to be determined before implantation. Integrity of mitochondria may be a prerequisite to a viable graft. A new method is presented, which allows...

.... The hepatic tissue lactate remained elevated. The mitochondrial activity was significantly reduced. A hyperglycemia (175 mg·dl -1 ) at 3 h changed into a hypoglycemia (50 mg·dl -1 ) at 6 h. It is suggested that Ld plus Etx causes a rapid impairment of hepatic mitochondria which leads to a drastic disturbance...

...J.F. Ngala Kenda; L. Lambotte In order to outline the relationship between oxidative phosphorylation, enzyme induction and rat liver regeneration, the effect of one single dose of phenobarbital (PB) on hepatic mitochondria, microsomes and DNA synthesis was investigated. Experiments were performed...

... mitochondria in the ligated lobe decreased to about 50% of controls 48 h after the ligation, while that in the nonligated lobe increased 2-fold. These rabbits continued to live. On the other hand, in the rabbits subjected to ligation of the common bile duct, the mitochondrial phosphorylative activity increased...

...) The mitochondria-selective K ATP channel opener diazoxide reduced infarct size as compared to control (p < 0.05); (2) IPC reduced infarct size and preserved postischemic diastolic function as compared to control (p < 0.05), and (3) the mitochondria-selective K ATP channel blocker 5-HD reversed these effects...

...M. Ueda; S. Kosaka; T. Hirata; T. Fukuse; Y. Suzuki; S. Hitomi; H. Wada Mitochondria of the small vasculature endothelial cells were examined in preserved rat lungs before and after reperfusion, and the ultrastructural changes were correlated with pulmonary function after reperfusion. Rat lungs...

.... Liver regeneration Triiodothyronine Mitochondria DNA Cytochrome c oxidase ATPase Triacylglycerols Original Paper Eur Surg Res 1998;30:371 377 Received: January 22, 1998 Accepted: May 12, 1998 Z. C ervinkova´ a R. Sva´ tkova´ a M. Kalousb H. Rauchova´ b M. C ervinkaa Z. Drahota b Effect...

... measured in smooth muscle purified mitochondria. Mitochondrial respiration showed significant differences in the LB versus anastomosed SB: respiratory rates were markedly reduced in the LB (residual activity: 25 vs. 95% of the SB). Detailed analysis of other mitochondrial parameters confirmed a better...