Effect of Baicalein on GLUT4 Translocation in Adipocytes of Diet-Induced Obese Mice Open Access

It has been clearly established that by a way of activating the glucose transporter 4 (GLUT4), insulin plays an essential role in glucose transport into adipocytes [1]. In adipocyte-specific GLUT4 knockout mice, glucose homeostasis is impaired and insulin resistance develops [2], while adipose tissue-specific GLUT4 over-expression mice exhibit improved insulin sensitivity and glucose homeostasis, even in obese and diabetic mice [3, 4]. Besides, during insulin resistance or type 2 diabetes, GLUT4 translocation to the plasma membrane is impaired [5]. An increase in the glucose transport amount is paralleled by the increase in GLUT4 density at cell plasma membranes [6], i.e. the increase in insulin sensitivity is mediated by translocation of more GLUT4 to the cell surface in response to insulin stimuli. Therefore, these findings have demonstrated that promotion of GLUT4 expression and translocation is essential for the maintenance of glucose homeostasis in the management of insulin resistance and type 2 diabetes.

Baicalein is a polyphenolic compound and a major bioactive flavonoid extracts from Scutellaria baicalensis [7]. A few studies reported that baicalein exhibits the anti-obesity, anti-diabetic, antioxidant and anti-inflammatory activities [8-12]. Baicalein was reported to have antihyperglycemic effects through the improvement of islet β-cell survival and mass [8]. Moreover, it was also found that treatment with baicalein to diabetes obviously stimulated the pPI3K and pAkt and inhibited the level of pGSK3β [11]. Additionally, the previous work verified that baicalein has been shown to increase insulin sensitivity in livers of diet-induced obese mice by blocking of AMPK-mediated MAPKs pathway [12]. Nevertheless, there are few reports about the effect of baicalein on insulin sensitivity and GLUT4 function of transporting glucose into adipocytes. So we used diet-induced obese mice to evaluate the effect of baicalein on GLUT4 function of glucose transportation in adipocytes.

Baicalein was purchased from Sigma-Aldrich, USA. Antibodies against P38MAPK (Cat. No. 9212), pP38MAPK (Cat. No. 4511), Akt (Cat. No. 4691), pAkt (Cat. No. 9271), ERK (Cat. No. 4695), pERK (Cat. No. 4377), Na, K-ATPase (Cat. No. 3010), UCP1 (Cat. No. 14670) and PPARγ (Cat. No. 2430) were acquired from Cell Signaling Technology Inc, USA. Antibodies against GLUT4 (Cat. No. 07-1404), and peroxisome proliferator-activated receptor-γ coactivator-1α (PGC-1α) (Cat. No. ST-1202) from Merck Millipore Inc, Germany. Antibodies against tubulin (Cat. No. BM1453) from BOSTER Inc, China. Insulin ELISA kits from Uscn Life Science, Inc. Wuhan, China.

All animal experiments were carried out in accordance with the guidelines of the Animal Care and Use Committee of Yangzhou University. Six-week-old male C57BL/6J mice were kept in a standard laboratory condition of temperature 21 ± 2°C, relative humidity 50 ± 15%, 12 hour light-dark cycles, with water and food available ad libitum. All animals used were closely monitored to ensure that none lived through stress and discomfort. The mice were fed a high fat diet (20% carbohydrates, 21% protein and 59% fat) for 16 weeks. Then the obese mice were divided into two groups: obese control group (n=8) and obese group with baicalein (n=8). Besides, a normal diet group (n=8) was set up. The mice in the obese group with baicalein were given 20mg/kg baicalein intraperitoneally (i.p.) once a day for continuous 21 days at 6: 00 am [13]. All controls were given vehicle (DMSO) i.p. The body weight of all mice was recorded every day. Food intake was monitored weekly throughout the experiments. At the end of the experiment, all mice were fasted for 12 h and used for glucose tolerance test as described below. All animals received human care and all study protocols were approved by the Animal Studies Committee of Yangzhou University.

After fasted for 12 h, 1.5 g/kg glucose dissolved in sterile water was i.p. injected into the mice after an overnight fast (12 h). The blood glucose levels in the tail vein blood were monitored at 0, 15, 30, 60 and 120 min after the glucose challenge using a Glucometer (HMD Biomedical, Taiwan). The areas under the curve (AUC) were calculated according to the formula [(FBG + BG 30 min) × 15/60 + (BG30 min + BG 60 min) × 15/60 + (BG 60 min + BG 120 min)× 30/60]. Fasting insulin challenge using competitive insulin ELISA kits according to the manufacturer’s specification. The assay range for insulin was 123.5–10000 pg/ ml, and intra-assay precision CV% < 10% and inter-assay precision CV% < 12%. The homeostasis model of insulin resistance (HOMA-IR) was calculated by fasting serum insulin concentration (mU/ml) ×fasting blood glucose level (mmol/L)/22.5. All measurements were performed in duplicate and the mean of two measurements was considered.

After fasted for 24 h all animals were sacrificed on the second day after the glucose tolerance test. Then 1 ml blood and all adipose tissues were fast collected. The blood samples were centrifugated at 3500 r.p.m. for 10 min to obtain the plasma which was stored at –80°C until further analysis. The adipose tissues were rinsed, weighed and frozen at –80°C too. This experiment was performed with the specific acceptance of the Animal Studies Committee of Yangzhou University.

Total RNA was extracted with Trizol from 100 mg epididymal fat pads. The RNA concentration was calculated by spectrophotometric assays of 260/280 nm, and the RNA integrity was assessed by running samples on a 1% formaldehyde agarose gel in TAE buffer (40 mmol/L tris-acetic acid, 1 mmol/L EDTA). cDNA was synthesized from 1 μg RNA using MMLV reverse transcriptase. Real-time quantitative PCR was performed for gene expression levels using real-time fluorescent detection in an Applied Biosystems 7500 real-time PCR instrument (ABI 7500, USA). The oligonucleotide primers were as follows: GLUT4 Forward Sequence 5’- GGCTTTGTGGCCTTCTTTGAG-3’, Reverse Sequence5’- GACCCATAGCATCCGCAACAT-3’; PGC-1α Forward Sequence 5’-ACCATGACTACTGTCAGTCACTC-3’, Reverse Sequence 5’-GTCACAGGAGGCATCTTTGAAG-3’; UCP1 Forward Sequence 5’- CTGGGCTTAACGGGTCCTC-3’, Reverse Sequence 5’-CTGGGCTAGGTAGTGCCAGTG-3’; PPARγ Forward Sequence 5’-AAGGCGAGGGCGATCTTG-3’, Reverse Sequence 5’-ATCATTAAGGAATTCATGTCGTAGATGAC -3’; GAPDH Forward Sequence 5’-AGAACATCATCCCTGCATCC -3’, Reverse Sequence5’- TCCACCACCCTGTTGCTGTA -3’. Amplification condition was: an initial denaturation at 95°C for 10 min; 95°C for 15 s, 62°C for 60 s, 40 cycles. The 2–ΔCT method was used to analyze the PCR data. GAPDH was used as an endogenous housekeeping gene.

Membranes of adipocytes were fractionated as described previously [14]. Briefly, the epididymal fat pads were washed, minced and homogenized in ice-cold homogenization buffer (250 mmol/ lsucrose, 2 mmol/l EDTA, 2.5 mmol/l Tris–HCl, 10 μg/ml aprotinin, 10 μg/ml leupeptin, and 100 μmol/l phenylmethylsulfonyl fluoride, pH 7.4), and then centrifuged at 13, 000 g for 20 min at 4 °C to remove the fat cake. The infranatant was centrifuged at 31, 000 g for 1 h to yield the low-density intracellular membranes. The pellet from the first spin was layered over a sucrose cushion and centrifuged at 75, 000 g for 1 h. The interphase was removed and spun at 39, 000 g for 20 min to yield the plasma membranes.

Total proteins of epididymal fat pads were extracted using RIPA agents and quantified with BCA protein assay kit to determine protein levels. Briefly, fifty micrograms of samples were separated by a 12% sodium dodecyl sulfate-polyacrylamide gel electrophoresis and transferred to a polyvinylidene difluoride filter membranes. Membranes were blocked in Tris-buffered saline (pH 7.5) containing 0.05% Tween-20 (1×TBST) and 5% skimmed milk for 2 h, then probed overnight at 4°C with an antibody against Na, K-ATPase, GLUT4, Tubulin, P38MAPK, AKT, ERK, pP38MAPK, pAKT, pERK, PGC-1α, UCP1 and PPARγ respectively. Membranes were washed with 1×TBST for 10 min and incubated for 2 h with horseradish peroxidase-conjugated secondary antibody. Lastly, immunoreactive bands were visualized by chemiluminescence and quantified by densitometry using a Quantity One Analysis Software (Bio-Rad).

SPSS 17.0 for Windows was used for statistical analysis. Comparisons between the means of three groups were analyzed by one-way ANOVA with Duncan’s tests. Data were presented as mean ± SEM with P < 0.05 as the limit for statistical significance.

All of the six-week-old mice used in this experiment exhibited similar body weight at the beginning of the experiment. Feeding of a high fat diet for 12 weeks enhanced body weight of the mice in obese control and baicalein groups compared with the normal diet group before the administration of baicalein (Fig. 1). As shown in Fig. 1 and Fig. 2 the body weight and weight of whole adipose tissues at 21 days were significantly decreased by 13.2% (P < 0.05) and 20.1% (P < 0.05) in the baicalein group compared with the obese controls, but increased by 51.2% (P< 0.01) and 468.3% (P< 0.01) in the obese control group compared with the normal controls, respectively. As shown in Fig. 3, the food intake of mice was significantly decreased by 37.5% (P< 0.01), 17.8% (P> 0.05) and 37.5% (P< 0.01) in the baicalein group compared with the obese controls, and by 87.3% (P< 0.01), 77.1% (P< 0.01) and 81.3% (P< 0.01) in the obese control group compared with the normal controls in the first, second and third week, respectively.

During the glucose tolerance test, as shown in Fig. 4A, the circulating glucose levels were markedly decreased by 23.6%, 13.1% and 19.8% at 0 min (P < 0.01), 60 min (P> 0.05) and 120 min (P < 0.05) in the baicalein group compared with obese controls, but increased by 45.7%, 20% and 81.8% at 0 min (P < 0.01), 60 min (P < 0.05) and 120 min (P < 0.01) in the obese control group compared with normal controls, respectively. As shown in Fig. 4B, the areas of glucose tolerance were significantly decreased by 12.8 (P < 0.05) in the baicalein group compared with the obese controls, but increased by 32.6% (P < 0.05) in the obese control group compared with normal controls.

As shown in Fig. 5, The blood insulin and glucose levels was decreased by 8.1 % (P > 0.05) and 21.6% (P < 0.01) in the baicalein group compared with the obese controls, but elevated by 52.0% (P < 0.01) and 38.3% (P < 0.01) in the obese control group compared with the normal controls (Fig. 5A and Fig. 5B). HOMA-IR index of mice was significantly decreased by 27.9% (P < 0.01) in the baicalein group compared with obese controls, but increased by 110.1% (P< 0.01) in the obese control group compared with normal controls.

As shown in Fig. 6, the PGC-1α mRNA and UCP1 mRNA expression levels were increased by 160% (P < 0.01) and 375% (P < 0.01) in baicalein group compared with obese controls, but decreased by 79.1% (P < 0.01) and 91.6% (P < 0.01) in the obese control group compared with the normal controls, respectively. Besides, the PPARγ mRNA expression level was reduced by 66.5 % (P < 0.01) in baicalein group compared with obese controls, but increased by 1156% (P < 0.01) in the obese control group compared with the normal controls, respectively (Fig. 6).

As shown in Fig. 7, the GLUT4 mRNA expression levels were increased by 38.7% (P < 0.05) in baicalein group compared with obese controls, but decreased by 97.4% (P < 0.01) in the obese control group compared with the normal controls, respectively. The GLUT4 protein level was elevated by 28.9 % (P < 0.05) in adipocytes of the baicalein group compared with the obese controls, but decreased by 57.5% (P< 0.01) in the obese control group compared with the normal controls (Fig. 7).

As shown in Fig. 8, the GLUT4 protein levels in the plasma membranes were increased by 37.5% (P < 0.05) in baicalein group compared with obese controls, but decreased by 53.6% (P < 0.01) in the obese control group compared with the normal controls, respectively (Fig. 8).

As shown in Fig. 9, the ratios of pAKT/AKT and PGC-1α as well as UCP1 contents were enhanced by 62.6% (P< 0.05), 105.6% (P< 0.01) and 67.3% (P< 0.05) in baicalein group compared with obese controls, but decreased by 71.9% (P< 0.01), 56.7% (P< 0.01) and 61.4% (P< 0.01) in obese control group compared with the normal controls, respectively. However, the ratios of pP38MAPK/P38MAPK and pERK/ERK as well as PPARγ level were reduced by 37.9% (P< 0.05), 81.9% (P < 0.01) and 70.3% (P < 0.01) in baicalein group compared with obese controls, but increased by 612.9% (P< 0.01), 819.5% (P< 0.01) and 323.2% (P< 0.01) in the obese control group compared with the normal controls, respectively.

Baicalein is a bioactive flavonoid isolated from the radix of Scutellaria baicalensis [7, 15]. Recent studies reported that baicalein might play an anti-obesity role [9, 12]. The supplementation of baicalein (400 mg/kg/d) in mice fed with high fat diet for 29 weeks ameliorated the severity of obesity and hyperlipidemia [12]. Furthermore, treatment of 3T3-L1 preadipocytes with baicalein inhibited the intracellular lipid accumulation during adipogenesis [16]. In accordance with these, the current results revealed that i.p. injection of baicalein decreased food intake, adipose tissue and body weight of diet-induced obese mice, further indicating that baicalein had the anti-obesity effects. In addition, baicalein appears to induce the expression of many genes associated with thermogenesis. It was found in the present study that the prolonged consumption of high-fat diet led to an increase in the expression of the adipogenic gene PPARγ along with the enhanced phosphorylation of the p38MAPK and ERK proteins in the epididymal adipose tissues of mice. Besides, high-fat diet strongly inhibited the PGC-1α and UCP1 protein expression in the epididymal adipose tissue. In this study, baicalein treatment led to the inhibition of ERK phosphorylation, resulting in decreased PPARγ expression and increased PGC-1a expression along with a subsequent elevation in UCP1 expression in the epididymal adipose tissue of mice. These results suggested that baicalein treatment led to increased thermogenesis and suppressed adipogenesis, respectively. Taken together, all of these results provided evidence in support of a role for baicalein in anti-obesity effects.

Furthermore, baicalein possessed the potency to ameliorate hyperglycemia and insulin resistance. In vitro, baicalein significantly increased glucose-stimulated insulin secretion in insulin secreting pancreatic INS382/13 cells and human islets culture [8]. Besides, baicalein was reported to have antihyperglycemic effects through the improvement of islet β-cell survival and mass [8]. Moreover, the supplementation of baicalein (400 mg/kg/d) in in mice fed with high fat diet for 29 weeks ameliorated insulin resistance and hyperglycemia through activation of AMPK signaling pathways in liver [12]. In the present study, treatment with baicalein in obese mice significantly decreased AUC and HOMA-IR values compared to the obese controls. These results indicate that baicalein can increase glucose uptake and insulin sensitivity.

Baicalein processes multitherapeutic activities, including anti-oxidant and anti-inflammatory properties. Insulin resistance is believed to be the result of chronic low-grade inflammation [17], which activated MAPK kinases, leading to phosphorylation of ERK and P38MAPK and causing insulin resistance of adipocytes [17-20]. In the present study, baicalein significantly reversed the upregulation of pP38MAPK as well as pERK in the adipocytes of diet-induced obese mice. These results suggested that baicalein potently inhibited proinflammatory responses in adipocytes by inhibiting MAP kinase kinases, leading to the decrease of pERK and pP38MAPK levels. Collectively, baicalein exerted its beneficial effects on high fat diet-induced insulin resistance in adipocytes by blocking of MAPKs signaling pathways.

Baicalein significantly reversed the down-regulation of PGC-1α and GLUT4 in adipocytes of diet-induced obese mice. On one hand, PGC-1α is a critical regulator of mitochondrial biogenesis in adipocytes and muscles to maintain an energy balance [21, 22]. PGC-1α can enhance the expression of GLUT4 to increase glucose uptake [23, 24]. Overexpressed PGC-1α increased glucose uptake in adipocytes and muscle [25]. On the other hand, GLUT4 is a particularly important glucose transporter for maintaining glucose homeostasis and insulin sensitivity in response to insulin stimuli. Its translocation from intracellular membrane compartments to plasma membranes is a rate-limiting step of glucose uptake and is closely associated with insulin resistance in adipocytes and skeletal muscle [26]. The current study found that administration of baicalein could upregulate GLUT4 and PGC-1α levels in adipocytes of diet-induced obese mice, suggesting that administration of baicalein enhanced PGC-1α levels to boost GLUT4 expression, resulting in the increase in glucose uptake [23, 24]. More interestingly, we found that the GLUT4 contents in the plasma membranes were markedly increased in adipocytes of baicalein-treated diet-induced obese mice, implicating that baicalein not only enhances GLUT4 expression levels, but also accelerates GLUT4 translocation from intracellular membrane compartments to plasma membranes in adipocytes.

To understand the signal mechanism that baicalein promotes GLUT4 translocation, we examined the levels of pAKT in adipocytes of diet-induced obese mice. Activated AKT may prevent insulin resistance through the GLUT4 translocation from intracellular membrane compartments to plasma membranes in adipocytes [27]. The results in the present study showed that treatment with baicalein enhanced pAkt contents to boost GLUT4 translocation and glucose uptake, suggesting that baicalein increased glucose uptake via the AKT/GLUT4 pathway.

In summary, our present work provided evidence that baicalein can promote GLUT4 translocation to prevent insulin resistance and type 2 diabetes. The major mechanisms of its action were up-regulation of PGC-1α and pAKT as well as the down-regulation of pP38MAPK and pERK in adipocytes. Altogether, these findings indicate that baicalein plays a significant role in regulation of glucose metabolic homeostasis and in elevation of insulin sensitivity to promote glucose clearance. This study contributes to our understanding of the antidiabetic effects of baicalein, and provides a possibility of using baicalein to treat type 2 diabetes in clinic. Further clinical studies are required to establish its clinical utility.

This work was supported by the National Natural Scientific Fund of China (No. 81673736; No. 81803792) and the Natural Scientific Fund of Jiangsu (No. BK20171319) and Qing Lan Project of Jiangsu.

The authors declared no conflict of interests.

W. Min, M. Wu and P. Fang contributed equally to this work.