Background/Aims: Ovarian cancer is one of the most common malignancies with a high rate of mortality in women. However, current therapies for ovarian cancer treatment are ineffective. Therefore, novel target identification is an urgent requisite. The present study aimed to investigate the role of microRNA-214 (miR-214) in ovarian cancer. Methods: The expression of miR-214, β-catenin, cyclin D1, c-myc, and TCF-1 at the transcriptional level was measured by real-time PCR, while that of β-catenin, Cyclin D1, and c-Myc at the protein level were detected by western blot. Colony formation assay and transwell assay were used to explore the invasion ability of the cancer cells. Cell cycle was measured by flow cytometry. Results: Real-time PCR showed that miR-214 expression in ovarian cancer cell lines was lower than that in the human normal ovarian epithelial cells, IOSE80. Furthermore, the low expression of miR-214 was correlated with high pathological grade. The rate of colony formation and invasion of miR-214 overexpression in SKOV-3 cells were weaker than that in control cells. Moreover, miR-214 overexpression led to the G0/G1 phase arrest. The expression of β-catenin, Cyclin D1, and c-Myc was suppressed by the overexpression of miR-214. Conclusion: These results suggested that miR-214 may serve as a tumor suppressor of ovarian cancer by targeting the β-catenin pathway.

Among the three most common gynecological malignancies, the rate of mortality of ovarian cancer is the highest, which might be attributed to the lack of early symptoms and specific and sensitive markers for the diagnosis of ovarian cancer [1, 2]. At the time of diagnosis, a majority of the women with ovarian cancer were in the advanced stages, and 70% would be deceased within 5 years [3]. Therefore, identifying the novel targets for ovarian cancer treatment is an urgent requirement.

MicroRNAs (miRNAs) are 22nt long single-stranded and non-coding RNAs, which regulate the gene expression via complementary binding to mRNA at the post-transcriptional level [4-7]. miRNAs were considered as oncogenes when highly expressed in cancer cells and tissues [8-11]. Conversely, the anti-oncogenic role of these miRNAs was elucidated post downregulation in cancer cells and tissues [8, 12, 13]. Therefore, the miRNA expression can indicate the prognosis of human cancers [14-18]. MicroRNA-214 (miR-214) has been found to be aberrantly expressed in different types of human tumors with varied roles in the development of cancers [19-24]. For instance, the expression of miR-214 was up-regulated in melanoma and promoted cancer cell progression by targeting TFAP2C and upregulating ALCAM [25, 26]. The overexpression of miR-214 was reported in gastric [27] and cervical cancers [28, 29]. However, in most cases, miR-214 was downregulated and exerted an anti-oncogenic role [30-33]. For example, miR-214 suppressed the cell proliferation, migration, and invasion by targeting MEK3, JNK1, Plexin-B1, and GALNT7 [29, 34, 35] in cervical cancer cells. In bladder cancer cells, miR-214 exerted tumor-suppressive effects by directly downregulating the level of PDRG1 [36]. Recently, miR-214 has been shown to induce apoptosis and sensitize breast cancer cells to doxorubicin by targeting the RFWD2-p53 cascade [37]. Nevertheless, the role of miR-214 in ovarian cancer remains controversial, while some researchers designated miR-214 as an oncogene, promoting cisplatin resistance [38] and radioresistance [39]. Interestingly, some studies suggested that miR-214 exhibits an anti-oncogenic role by suppressing the ovarian cancer cell proliferation (27) and promoting the chromosomal instability of cancer cells [40]. Therefore, the present study aimed to investigate the expression and role of miR-214 in ovarian cancer cells.

Human tissue specimens

Between 2013 and 2015, 32 normal ovarian tissues and 23 benign ovarian tumor tissues were obtained from the Second Affiliated Hospital of Kunming Medical College. Furthermore, 127 malignant ovarian cancer tissues at I–IV stage, classified according to the FIGO classification, were obtained from the Second Affiliated Hospital of Kunming Medical College and the Third Affiliated Hospital of Kunming Medical College. Ovarian cancer tissues were histologically examined by two independent pathologists using hematoxylin-eosin (H&E) staining. None of the patients received any medication within 3 months before surgery. To prevent RNA degradation, the tissues were maintained in liquid nitrogen immediately after excision. The study protocol was approved and supervised by the Ethics Committee of Kunming Medical University. All patients provided written informed consent form before the experiment.

Cell culture

SKOV-3, OVCAR-3, and A2780 ovarian cancer cell lines and IOSE80 normal ovarian epithelial cell line were purchased from Yingrun Biological Co., Ltd. (Changsha, China). SKOV-3, OVCAR-3, and A2780 were cultured in 1640 medium (HyClone, USA), supplemented with 10% (v/v) fetal bovine serum (FBS; HyClone) and 1/100 penicillin-streptomycin (Invitrogen, Carlsbad, CA, USA). IOSE80 cells were maintained in Dulbecco’s Modified Eagle Medium (DMEM; HyClone) with high glucose, supplemented with 10% (v/v) FBS, supplemented with 1/100 penicillin-streptomycin. HEK-293T cell line was obtained from ATCC and cultured in DMEM containing 10% (v/v) FBS and supplemented with 1/100 penicillin-streptomycin. All cell lines were cultured in a humidified atmosphere of 5% CO2 and 95% air at 37 °C.

Real-time PCR (RT-PCR) assay

Total RNA was extracted using TRIzol (Invitrogen), according to the manufacturer’s instructions. Total RNA was subjected to cDNA synthesis and RT-PCR as described previously (2). U6 snRNA was used as an internal standard to normalize the expression of miR-214. For the expression analysis of β-catenin, cyclin D1, c-myc, and TCF-1, β-actin was used as a reference gene. The specific primer pairs were shown in Table 1. The expression data were analyzed using 2-ΔΔCt method.

Table 1.

Specific primers used in the experiment

Specific primers used in the experiment
Specific primers used in the experiment

H&E staining

Tissue sections were fixed in 4% paraformaldehyde for 4 h. Then, the sections were deparaffinized in xylene and successively rehydrated with an alcohol gradient. Subsequently, the sections were H&E stained and rinsed with distilled water, followed by examination under a microscope (Olympus, Japan).

Lentivirus packaging and stable cell line establishment

MiR-214 and control mi-RNA precursors were cloned into pEZX-MR04 (GeneCopoeiaTM, USA) and termed as pLV-miR-214 and pLV-miR-control, respectively. pLV-miR-214 or pLV-miR-control was transfected into HEK293T cells according to the manufacturer’s instructions (GeneCopoeia). The transfection efficacy was evaluated by inverted fluorescence microscopy (Olympus). After 48 h, the cell supernatant was harvested, filtered, and cleared by centrifugation at 500 ×g for 10 min. Three days post-infection in SKOV3 cells, 2 µg/mL puromycin was added to screen the successfully infected cells. The sequences of miR-214 and control microRNA precursor (5’–3’) were as follows: miR-214, forward: ACAGCAGGCACAGACAGGCAGU, reverse: UGCCUGUCUGUGCCUGCUGUUU; control, forward: ACAGCAGGCACAGACAGGCAGU, reverse: UGCCUGUCUGUGCCUGCUGUUU. The cells transfected with pLV-miR-214 were termed as SKOV-3-miR-214, and pLV-miR-control-transfected cell line was named as SKOV-3-miR-Control. The expression of miR-214 was detected by real-time PCR.

Western blot analysis

Cells were lysed using RIPA lysis buffer (Beyotime, China). The BCA protein assay kit (Pierce, Rockford, IL, USA) was used to evaluate the protein concentration. An equivalent amount of protein (30 mg) was separated by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (12% SDS–PAGE) and transferred to polyvinylidene fluoride (PVDF) membrane. Then, the membranes were incubated with 5% non-fat milk for 60 min and probed with primary antibodies to b-catenin (Cell Signaling Technology, Danvers, MA, USA; 1: 1000), Cyclin D1 (Cell Signaling Technology, 1: 1000), c-Myc (Cell Signaling Technology, 1: 1000), TCF-1 (Cell Signaling Technology, 1: 1000), and b-actin (Abcam, Cambridge, UK 1: 1000) overnight at 4 °C. Then, the membranes were incubated with the corresponding HRP-conjugated secondary antibodies for 2 h at room temperature. Consequently, the bands were visualized using an enhanced chemiluminescence system (ECL, Pierce).

Cell colony assay

SKOV-3-miR-214 and SKOV-3-miR-Control cells were cultured for 2 weeks in soft agar plates, respectively. Subsequently, the colonies were observed using an inverted phase contrast microscope. The colony formation ratio was calculated using the following equation: colony formation ratio (%) = (number of colonies/number of seeded cells) × 100.

Cell cycle

Cells were lysed and fixed in ice-cold 75% ethanol for 24 h at 4 °C. Then, propidium iodide (PI) was added, and the cells placed in the dark for 30 min. The cell cycles were analyzed using flow cytometry (Beckman Coulter, USA).

Transwell assay

SKOV-3-miR-214 cells (SKOV-3-miR-control and WT SKOV-3) were pre-incubated for 24 h at 37 °C, followed by detachment and resuspended in serum-free medium. A total of 6000 cells were seeded in the upper chamber, and 10% serum medium was placed as a chemoattractant in the lower chamber of Matrigel-coated transwells. After incubation for 9 h, the membranes were fixed with methanol for 1 h and stained with 1% crystal violet. Finally, the membranes were placed on a glass slide and scanned using a microscope (Olympus, Japan). The number of migrating cells in five fields per chamber was counted and averaged.

Statistical analysis

Student’s t-test or one-way ANOVA was used for statistical analysis when appropriate. All statistical analyses were performed using SPSS 19.0 (SPSS Inc., Chicago, IL, USA). A two-tailed P-value < 0.05 was considered to be statistically significant.

MiR-214 expression was downregulated in ovarian cancer cells and tissues

RT-PCR was used to investigate the expression of miR-214 in ovarian cancer cells and tissues. The tissues were examined by H&E staining (Fig. 1A). No significant differences were observed in the expression level of miR-214 between benign ovarian tumor tissues and normal ovarian tissues. However, the malignant tissues had a significantly lower expression level of miR-214 than the innocent ovarian tumor and normal tissues (P < 0.05, Fig. 1B). The expression was inversely correlated with the pathological grade (Fig. 1B). Furthermore, the miR-214 expression in ovarian cancer cell lines was significantly lower than in the ISOE 80 cells (P < 0.05, Fig. 1C). These results suggested the potential tumor suppressor role of miR-214 in ovarian cancer.

Fig. 1.

The expression of miR-214 was low in ovarian cancer. A. H&E staining for ovarian cancer tissues. B. Relative expression of miR-214 in ovarian cancer, innocent tumors, and normal ovarian tissues. *P<0.05, **P<0.001 compared to the innocent tumor. C. Evaluation of the expression of miR-214 in ovarian cancer cells and normal epithelial ovarian cell line IOSE80. *P<0.05, **P<0.001 compared to the IOSE80. All experiments were performed in triplicate.

Fig. 1.

The expression of miR-214 was low in ovarian cancer. A. H&E staining for ovarian cancer tissues. B. Relative expression of miR-214 in ovarian cancer, innocent tumors, and normal ovarian tissues. *P<0.05, **P<0.001 compared to the innocent tumor. C. Evaluation of the expression of miR-214 in ovarian cancer cells and normal epithelial ovarian cell line IOSE80. *P<0.05, **P<0.001 compared to the IOSE80. All experiments were performed in triplicate.

Close modal

miR-214 overexpression inhibited the colony formation and cell invasion

To explore the physiological role of miR-214 in ovarian cancer cells, it was stably transfected into SKOV-3 cells; and the construct was termed as SKOV-3-miR-214. The transfection efficiency was measured by a microscope and the miR-214 expression confirmed by RT-PCR (Fig. 2). Then, the colony formation ability was detected. As expected, the colony formation ability of SKOV-3-miR-214 was dramatically decreased as compared to the SKOV-3-control and WT SKOV-3 cell lines (Fig. 3A-B). Apparently, the growth and proliferation of SKOV-3-miR-214 were inhibited by the overexpression of miR-214 (Fig. 3C). The transwell invasion assay was conducted to investigate cancer progression since the invasion is a critical feature in cancer. As shown in Fig. 4, the invasion capacity of SKOV-3-miR-214 cells was significantly lower than the SKOV-3-miR-control and WT SKOV-3 cells. These results indicated that the overexpression of miR-214 abrogated ovarian cancer invasion capacity and colony formation ability.

Fig. 2.

Over-expression of miR-214 in SKOV-3 cells. A. Transfection efficiency was evaluated by immunofluorescence staining. Green fluorescence indicated that the cells were successfully transfected. B. 72 h post-transfection, the expression of miR-214 was detected by RT-PCR. The experiments were repeated three times. *P<0.05 compared to the control.

Fig. 2.

Over-expression of miR-214 in SKOV-3 cells. A. Transfection efficiency was evaluated by immunofluorescence staining. Green fluorescence indicated that the cells were successfully transfected. B. 72 h post-transfection, the expression of miR-214 was detected by RT-PCR. The experiments were repeated three times. *P<0.05 compared to the control.

Close modal
Fig. 3.

Cells invasion ability and cell proliferation were attenuated by miR-214 overexpression. A. Transwell invasion assay. B. Statistical analysis of invasive cells of (A). C. Cell proliferation was attenuated by overexpression of miR-214. The experiments were performed in triplicate. *P<0.05 compared to the control.

Fig. 3.

Cells invasion ability and cell proliferation were attenuated by miR-214 overexpression. A. Transwell invasion assay. B. Statistical analysis of invasive cells of (A). C. Cell proliferation was attenuated by overexpression of miR-214. The experiments were performed in triplicate. *P<0.05 compared to the control.

Close modal
Fig. 4.

MiR-214 overexpression lowered colony forming ability of ovarian cells. The colony forming ability of ovarian cancer cells was decreased as a result of overexpression of miR-214. All the experiments were repeated in triplicate. *P<0.05 compared to the control.

Fig. 4.

MiR-214 overexpression lowered colony forming ability of ovarian cells. The colony forming ability of ovarian cancer cells was decreased as a result of overexpression of miR-214. All the experiments were repeated in triplicate. *P<0.05 compared to the control.

Close modal

miR-214 overexpression led to cell cycle arrest

Next, we speculated that the overexpression of miR-214 might be involved in cell cycle. Compared to SKOV-3-Control and WT SKOV-3 cell lines, a higher ratio of SKOV-3-miR-214 cells was observed in the G1/S phase (Fig. 5). These results indicated that miR-214 might inhibit cell proliferation by inducing cell cycle arrest in the G1/S phase.

Fig. 5.

Post miR-214 overexpression, ovarian cancer cell cycle was arrested at G1/S phase. A. Post miR-214 was overexpressed in SKOV3 cells, cell cycles were detected by flow cytometry. B. The ratio of specific cell cycle phases was determined. All the experiments were repeated three times, *P<0.05 compared to the control.

Fig. 5.

Post miR-214 overexpression, ovarian cancer cell cycle was arrested at G1/S phase. A. Post miR-214 was overexpressed in SKOV3 cells, cell cycles were detected by flow cytometry. B. The ratio of specific cell cycle phases was determined. All the experiments were repeated three times, *P<0.05 compared to the control.

Close modal

miR-214 suppressed β-catenin pathway

β-catenin was reported to be involved in the downstream physiological mechanism of miR-214 in different types of cancer cells [41-45]. Therefore, the expression of β-catenin, as well as its downstream proteins, including CyclinD1, c-Myc, and TCF-1, was assessed by western blot and RT-PCR. As shown in Fig. 6, the mRNA expression of β-catenin, cyclin D1, and c-myc in SKOV-3-miR-214 cells was significantly higher than that in SKOV-3-control and WT SKOV-3 cells. On the other hand, the mRNA expression of TCF-1 was similar among the three groups. Furthermore, western blot analysis revealed that the expression of β-catenin, Cyclin D1, c-Myc, and TCF-1 in SKOV-3-miR-214 cells was significantly lower than that in SKOV-3-control and WT SKOV-3 cells (Fig. 6). Taken together, these results suggested that miR-214 may suppress the expression of β-catenin in SKOV-3 cells.

Fig. 6.

Expression of β-catenin, Cy-clinD1, and c-Myc was suppressed by miR-214 overexpression. A. Relative expression of β-catenin, cyclin D1, and c-myc at mRNA level. B. Expression of β-catenin, Cyclin D1, and c-Myc at the protein level. C. Protein expression levels were quantified by densitometry and normalized to β-actin. All the experiments were repeated three times, *P<0.05 compared to the control.

Fig. 6.

Expression of β-catenin, Cy-clinD1, and c-Myc was suppressed by miR-214 overexpression. A. Relative expression of β-catenin, cyclin D1, and c-myc at mRNA level. B. Expression of β-catenin, Cyclin D1, and c-Myc at the protein level. C. Protein expression levels were quantified by densitometry and normalized to β-actin. All the experiments were repeated three times, *P<0.05 compared to the control.

Close modal

The role of miR-214 remains controversial in ovarian cancer cells. The present study revealed that miR-214 expression was downregulated in ovarian cancer tissues and cells. Furthermore, the miR-214 expression was negatively correlated to the pathological grade. Functional studies revealed that miR-214 overexpression lowered the invasion ability and transwell migration ability of the cancer cells and impeded the cell cycle. In addition, β-catenin was found to be involved in the physiological role of miR-214. These results indicated that miR-214 might be a tumor suppressor in ovarian cancer.

An in-depth understanding of the physiological and pathophysiological mechanisms of miRNAs may provide a novel strategy for the diagnosis and therapy of diseases [6, 46, 47]. The present study demonstrated that miR-214 was downregulated in ovarian cancer cells and negatively related to the pathological grade, thereby designating its role as a tumor suppressor in ovarian cancer. These results were in agreement with those from previous studies [28, 30, 37, 43, 48-51]. Furthermore, to explore the tumor suppressor role of miR-214, we constructed the stably expressing miR-214 SKOV-3 cell lines and examined its effect on the cellular function. Results showed that the overexpression of miR-214 inhibited the colony formation, which was consistent with that described previously [29, 36, 38]. Also, the overexpression of miR-214 led to ovarian cancer cell cycle arrest at G1/S phase, similar to the previous results [50].

MiRNAs exerted a physiological effect on the cellular function by regulating the gene expression; Plexin-B1, PTEN, p53/Nanog, and Wnt/β-catenin pathways have been identified as targets of miR-214 [45, 52]. Among these, Wnt/β-catenin pathway was involved in the embryonic development, self-renewal of the tissue [53], and cell proliferation [54, 55]. In the present study, the expression of β-catenin, Cyclin D1, TCF-1, and c-Myc was downregulated in SKOV-3-miR-214 cells, which was confirmed by miR-214-mediated inhibition on Wnt/β signaling pathway [42, 43].

miR-214 may act as a tumor suppressor in ovarian cancer, indicating that it might serve as a target for the treatment of ovarian cancer. However, additional studies are essential to reveal the precise mechanisms underlying miR-214 in ovarian cancer.

This study was supported by the Key Project of Educational Department in Yunnan Province (No. 2015Z081), Health Science and Technology Plan Project (Nos. 2014NS092, 2016NS286, 2016NS287, and 2017NS277), and Yunnan Health Training Project of High-Level Talents (No. H-201629).

The authors have no conflicts of interest to disclose.

1.
Son JH, Kong TW, Paek J, Song KH, Chang SJ, Ryu HS: Clinical characteristics and prognostic inflection points among long-term survivors of advanced epithelial ovarian cancer. Int J Gynaecol Obstet DOI: 10.1002/ijgo.12315.
2.
Qin D, Wang W, Lei H, Luo H, Cai H, Tang C, Wu Y, Wang Y, Jin J, Xiao W, Wang T, Ma C, Xu H, Zhang J, Gao F, Wu YL: CDDO-Me reveals USP7 as a novel target in ovarian cancer cells. Oncotarget 2016; 7: 77096-77109.
3.
Zhang W, Ye B, Liang W, Ren Y: Preoperative prognostic nutritional index is a powerful predictor of prognosis in patients with stage III ovarian cancer. Sci Rep 2017; 7: 9548.
4.
Melkamu T, Zhang X, Tan J, Zeng Y, Kassie F: Alteration of microRNA expression in vinyl carbamate-induced mouse lung tumors and modulation by the chemopreventive agent indole-3-carbinol. Carcinogenesis 2010; 31: 252-258.
5.
Tili E, Michaille JJ, Cimino A, Costinean S, Dumitru CD, Adair B, Fabbri M, Alder H, Liu CG, Calin GA, Croce CM: Modulation of miR-155 and miR-125b levels following lipopolysaccharide/TNF-alpha stimulation and their possible roles in regulating the response to endotoxin shock. J Immunol 2007; 179: 5082-5089.
6.
Tian S, Tian J, Chen X, Li L, Liu Y, Wang Y, Sun Y, Zhang C, Lou G: Identification of Subpathway Signatures For Ovarian Cancer Prognosis by Integrated Analyses of High-Throughput miRNA and mRNA Expression. Cell Physiol Biochem 2017; 44: 1325-1336.
7.
Worku T, Bhattarai D, Ayers D, Wang K, Wang C, Rehman ZU, Talpur HS, Yang L: Long Non-Coding RNAs: the New Horizon of Gene Regulation in Ovarian Cancer. Cell Physiol Biochem 2017; 44: 948-966.
8.
Huang N, Lin J, Ruan J, Su N, Qing R, Liu F, He B, Lv C, Zheng D, Luo R: MiR-219-5p inhibits hepatocellular carcinoma cell proliferation by targeting glypican-3 FEBS Lett 2012; 586: 884-891.
9.
Hou M, Zuo X, Li C, Zhang Y, Teng Y: Mir-29b Regulates Oxidative Stress by Targeting SIRT1 in Ovarian Cancer Cells. Cell Physiol Biochem 2017; 43: 1767-1776.
10.
Han X, Zhen S, Ye Z, Lu J, Wang L, Li P, Li J, Zheng X, Li H, Chen W, Li X, Zhao L: A Feedback Loop Between miR-30a/c-5p and DNMT1 Mediates Cisplatin Resistance in Ovarian Cancer Cells. Cell Physiol Biochem 2017; 41: 973-986.
11.
Chen H, Liu C, Jiang H, Gao Y, Xu M, Wang J, Liu S, Fu Y, Sun X, Xu J, Zhang J, Dai L: Regulatory Role of miRNA-375 in Expression of BMP15/GDF9 Receptors and its Effect on Proliferation and Apoptosis of Bovine Cumulus Cells. Cell Physiol Biochem 2017; 41: 439-450.
12.
Teng Y, Zuo X, Hou M, Zhang Y, Li C, Luo W, Li X: A Double-Negative Feedback Interaction between MicroRNA-29b and DNMT3A/3B Contributes to Ovarian Cancer Progression. Cell Physiol Biochem 2016; 39: 2341-2352.
13.
Ying X, Wei K, Lin Z, Cui Y, Ding J, Chen Y, Xu B: MicroRNA-125b Suppresses Ovarian Cancer Progression via Suppression of the Epithelial-Mesenchymal Transition Pathway by Targeting the SET Protein. Cell Physiol Biochem 2016; 39: 501-510.
14.
Gallach S, Jantus-Lewintre E, Calabuig-Farinas S, Montaner D, Alonso S, Sirera R, Blasco A, Uso M, Guijarro R, Martorell M, Camps C: MicroRNA profiling associated with non-small cell lung cancer: next generation sequencing detection, experimental validation, and prognostic value. Oncotarget 2017; 8: 56143-56157.
15.
Mahmoudian-Sani MR, Mehri-Ghahfarrokhi A, Asadi-Samani M, Mobini GR: Serum miRNAs as Biomarkers for the Diagnosis and Prognosis of Thyroid Cancer: A Comprehensive Review of the Literature. Eur Thyroid J 2017; 6: 171-177.
16.
Wang H, Luo J, Liu C, Niu H, Wang J, Liu Q, Zhao Z, Xu H, Ding Y, Sun J, Zhang Q: Investigating MicroRNA and transcription factor co-regulatory networks in colorectal cancer. BMC Bioinformatics 2017; 18: 388.
17.
Shao Y, Gu W, Ning Z, Song X, Pei H, Jiang J: Evaluating the Prognostic Value of microRNA-203 in Solid Tumors Based on a Meta-Analysis and the Cancer Genome Atlas (TCGA) Datasets. Cell Physiol Biochem 2017; 41: 1468-1480.
18.
Li P, Sun Y, Liu Q: MicroRNA-340 Induces Apoptosis and Inhibits Metastasis of Ovarian Cancer Cells by Inactivation of NF-x03BA;B1. Cell Physiol Biochem 2016; 38: 1915-1927.
19.
Gong Y, Yang H, Tian X: Elucidating the mechanism of miRNA-214 in the regulation of gingival carcinoma. Exp Ther Med 2017; 13: 2544-2550.
20.
Li JH, Zhang SQ, Qiu XG, Zhang SJ, Zheng SH, Zhang DH: Long non-coding RNA NEAT1 promotes malignant progression of thyroid carcinoma by regulating miRNA-214. Int J Oncol 2017; 50: 708-716.
21.
Ecke TH, Stier K, Weickmann S, Zhao Z, Buckendahl L, Stephan C, Kilic E, Jung K: miR-199a-3p and miR-214-3p improve the overall survival prediction of muscle-invasive bladder cancer patients after radical cystectomy. Cancer Med 2017; 6: 2252-2262.
22.
Gou X, Zhao X, Wang Z: Long noncoding RNA PVT1 promotes hepatocellular carcinoma progression through regulating miR-214. Cancer Biomark DOI: 10.3233/cbm-170331.
23.
Li TK, Yin K, Chen Z, Bao Y, Zhang SX: MiR-214 regulates oral cancer KB cell apoptosis through targeting RASSF5. Genet Mol Res 2017; 16:gmr16019327.
24.
Penna E, Orso F, Taverna D: miR-214 as a key hub that controls cancer networks: small player, multiple functions. J Invest Dermatol 2015; 135: 960-969.
25.
Penna E, Orso F, Cimino D, Tenaglia E, Lembo A, Quaglino E, Poliseno L, Haimovic A, Osella-Abate S, De Pitta C, Pinatel E, Stadler MB, Provero P, Bernengo MG, Osman I, Taverna D: microRNA-214 contributes to melanoma tumour progression through suppression of TFAP2C. Embo J 2011; 30: 1990-2007.
26.
Penna E, Orso F, Cimino D, Vercellino I, Grassi E, Quaglino E, Turco E, Taverna D: miR-214 coordinates melanoma progression by upregulating ALCAM through TFAP2 and miR-148b downmodulation. Cancer Res 2013; 73: 4098-4111.
27.
Xin R, Bai F, Feng Y, Jiu M, Liu X, Bai F, Nie Y, Fan D: MicroRNA-214 promotes peritoneal metastasis through regulating PTEN negatively in gastric cancer. Clin Res Hepatol Gastroenterol 2016; 40: 748-754.
28.
Wang JM, Ju BH, Pan CJ, Gu Y, Li MQ, Sun L, Xu YY, Yin LR: MiR-214 inhibits cell migration, invasion and promotes the drug sensitivity in human cervical cancer by targeting FOXM1. Am J Transl Res 2017; 9: 3541-3557.
29.
Yang Z, Chen S, Luan X, Li Y, Liu M, Li X, Liu T, Tang H: MicroRNA-214 is aberrantly expressed in cervical cancers and inhibits the growth of HeLa cells. IUBMB Life 2009; 61: 1075-1082.
30.
Peng R, Men J, Ma R, Wang Q, Wang Y, Sun Y, Ren J: miR-214 down-regulates ARL2 and suppresses growth and invasion of cervical cancer cells. Biochem Biophys Res Commun 2017; 484: 623-630.
31.
Guo Y, Li L, Gao J, Chen X, Sang Q: miR-214 suppresses the osteogenic differentiation of bone marrow-derived mesenchymal stem cells and these effects are mediated through the inhibition of the JNK and p38 pathways. Int J Mol Med 2017; 39: 71-80.
32.
He GY, Hu JL, Zhou L, Zhu XH, Xin SN, Zhang D, Lu GF, Liao WT, Ding YQ, Liang L: The FOXD3/miR-214/MED19 axis suppresses tumour growth and metastasis in human colorectal cancer. Br J Cancer 2016; 115: 1367-1378.
33.
Zhao J, Pan Y, Li X, Zhang X, Xue Y, Wang T, Zhao S, Hou Y: Dihydroartemisinin and Curcumin Synergistically Induce Apoptosis in SKOV3 Cells Via Upregulation of MiR-124 Targeting Midkine. Cell Physiol Biochem 2017; 43: 589-601.
34.
Zhang LL, Guo YJ, Zhao CN, Gao JY: Effects and mechanism of miR-214 on hepatocellular carcinoma. Asian Pac J Trop Med 2015; 8: 392-398.
35.
Xu CX, Xu M, Tan L, Yang H, Permuth-Wey J, Kruk PA, Wenham RM, Nicosia SV, Lancaster JM, Sellers TA, Cheng JQ: MicroRNA miR-214 regulates ovarian cancer cell stemness by targeting p53/Nanog. J Biol Chem 2012; 287: 34970-34978.
36.
Wang J, Zhang X, Wang L, Yang Y, Dong Z, Wang H, Du L, Wang C: MicroRNA-214 suppresses oncogenesis and exerts impact on prognosis by targeting PDRG1 in bladder cancer. PLoS One 2015; 10:e0118086.
37.
Liu Y, Zhou H, Ma L, Hou Y, Pan J, Sun C, Yang Y, Zhang J: MiR-214 suppressed ovarian cancer and negatively regulated semaphorin 4D. Tumour Biol 2016; 37: 8239-8248.
38.
Yang H, Kong W, He L, Zhao JJ, O’Donnell JD, Wang J, Wenham RM, Coppola D, Kruk PA, Nicosia SV, Cheng JQ: MicroRNA expression profiling in human ovarian cancer: miR-214 induces cell survival and cisplatin resistance by targeting PTEN. Cancer Res 2008; 68: 425-433.
39.
Zhang Q, Zhang S: miR-214 promotes radioresistance in human ovarian cancer cells by targeting PETN. Biosci Rep 2017; 37:BSR20170327.
40.
Wang Z, Yin H, Zhang Y, Feng Y, Yan Z, Jiang X, Bukhari I, Iqbal F, Cooke HJ, Shi Q: miR-214-mediated downregulation of RNF8 induces chromosomal instability in ovarian cancer cells. Cell Cycle 2014; 13: 3519-3528.
41.
Gu C, Zhou XD, Yuan Y, Miao XH, Liu Y, Ru YW, Li KQ, Li G: MicroRNA-214 induces dendritic cell switching from tolerance to immunity by targeting beta-Catenin signaling. Int J Clin Exp Pathol 2015; 8: 10050-10060.
42.
Xu Y, Lu S: Regulation of beta-catenin-mediated esophageal cancer growth and invasion by miR-214 Am J Transl Res 2015; 7: 2316-2325.
43.
Yi SJ, Li LL, Tu WB: MiR-214 negatively regulates proliferation and WNT/beta-catenin signaling in breast cancer. Eur Rev Med Pharmacol Sci 2016; 20: 5148-5154.
44.
Zhu XB, Zhang ZC, Han GS, Han JZ, Qiu DP: Overexpression of miR214 promotes the progression of human osteosarcoma by regulating the Wnt/betacatenin signaling pathway. Mol Med Rep 2017; 15: 1884-1892.
45.
Xia H, Ooi LL, Hui KM: MiR-214 targets beta-catenin pathway to suppress invasion, stem-like traits and recurrence of human hepatocellular carcinoma. PLoS One 2012; 7:e44206.
46.
Jarvis WD, Fornari FA, Traylor RS, Martin HA, Kramer LB, Erukulla RK, Bittman R, Grant S: Induction of apoptosis and potentiation of ceramide-mediated cytotoxicity by sphingoid bases in human myeloid leukemia cells. J Biol Chem 1996; 271: 8275-8284.
47.
Garzon R, Fabbri M, Cimmino A, Calin GA, Croce CM: MicroRNA expression and function in cancer. Trends Mol Med 2006; 12: 580-587.
48.
Chandrasekaran KS, Sathyanarayanan A, Karunagaran D: MicroRNA-214 suppresses growth, migration and invasion through a novel target, high mobility group AT-hook 1, in human cervical and colorectal cancer cells. Br J Cancer 2016; 115: 741-751.
49.
Zhang J, Su B, Gong C, Xi Q, Chao T: miR-214 promotes apoptosis and sensitizes breast cancer cells to doxorubicin by targeting the RFWD2-p53 cascade. Biochem Biophys Res Commun 2016; 478: 337-342.
50.
Yang Y, Chang S, Zhao Z, Hou NI, He K, Wang X, Gao L, Wang L, Cai D, Guo BO, Tong D, Song T, Huang C: MicroRNA-214 suppresses the proliferation of human hepatocellular carcinoma cells by targeting E2F3 Oncol Lett 2015; 10: 3779-3784.
51.
Heishima K, Mori T, Sakai H, Sugito N, Murakami M, Yamada N, Akao Y, Maruo K: MicroRNA-214 Promotes Apoptosis in Canine Hemangiosarcoma by Targeting the COP1-p53 Axis. PLoS One 2015; 10:e0137361.
52.
Wang X, Chen J, Li F, Lin Y, Zhang X, Lv Z, Jiang J: MiR-214 inhibits cell growth in hepatocellular carcinoma through suppression of beta-catenin. Biochem Biophys Res Commun 2012; 428: 525-531.
53.
Clevers H: Wnt/beta-catenin signaling in development and disease. Cell 2006; 127: 469-480.
54.
Fodde R, Brabletz T: Wnt/beta-catenin signaling in cancer stemness and malignant behavior. Curr Opin Cell Biol 2007; 19: 150-158.
55.
Huang H, He X: Wnt/beta-catenin signaling: new (and old) players and new insights. Curr Opin Cell Biol 2008; 20: 119-125.

Y. Liu and J. Lin contributed equally to this work.

Open Access License / Drug Dosage / Disclaimer
This article is licensed under the Creative Commons Attribution-NonCommercial-NoDerivatives 4.0 International License (CC BY-NC-ND). Usage and distribution for commercial purposes as well as any distribution of modified material requires written permission. Drug Dosage: The authors and the publisher have exerted every effort to ensure that drug selection and dosage set forth in this text are in accord with current recommendations and practice at the time of publication. However, in view of ongoing research, changes in government regulations, and the constant flow of information relating to drug therapy and drug reactions, the reader is urged to check the package insert for each drug for any changes in indications and dosage and for added warnings and precautions. This is particularly important when the recommended agent is a new and/or infrequently employed drug. Disclaimer: The statements, opinions and data contained in this publication are solely those of the individual authors and contributors and not of the publishers and the editor(s). The appearance of advertisements or/and product references in the publication is not a warranty, endorsement, or approval of the products or services advertised or of their effectiveness, quality or safety. The publisher and the editor(s) disclaim responsibility for any injury to persons or property resulting from any ideas, methods, instructions or products referred to in the content or advertisements.