P38 Kinase, SGK1 and NF-κB Dependent Up-Regulation of Na+/Ca2+ Exchanger Expression and Activity Following TGFß1 Treatment of Megakaryocytes

Al-Maghout, Tamer; Pelzl, Lisann; Sahu, Itishri; Sukkar, Basma; Hosseinzadeh, Zohreh; Gutti, Ravi; Laufer, Stefan; Voelkl, Jakob; Pieske, Burkert; Gawaz, Meinrad; Lang, Florian

doi:10.1159/000479992

Abstract

Background: TGFβ1, a decisive regulator of megakaryocyte maturation and platelet formation, has previously been shown to up-regulate both, store operated Ca²⁺ entry (SOCE) and Ca²⁺ extrusion by Na⁺/Ca²⁺ exchange. The growth factor thus augments the increase of cytosolic Ca²⁺ activity ([Ca²⁺]_i) following release of Ca²⁺ from intracellular stores and accelerates the subsequent decline of [Ca²⁺]_i. The effect on SOCE is dependent on a signaling cascade including p38 kinase, serum & glucocorticoid inducible kinase SGK1, and nuclear factor NFκB. The specific Na⁺/Ca²⁺ exchanger isoforms involved and the signalling regulating the Na⁺/Ca²⁺ exchangers remained, however elusive. The present study explored, whether TGFβ1 influences the expression and function of K⁺ insensitive (NCX) and K⁺ sensitive (NCKX) Na⁺/Ca²⁺ exchangers, and aimed to shed light on the signalling involved. Methods: In human megakaryocytic cells (MEG01) RT-PCR was performed to quantify NCX/NCKX isoform transcript levels, [Ca²⁺]_i was determined by Fura-2 fluorescence, and Na⁺/Ca²⁺ exchanger activity was estimated from the increase of [Ca²⁺]_i following switch from an extracellular solution with 130 or 90 mM Na⁺ and 0 mM Ca²⁺ to an extracellular solution with 0 Na⁺ and 2 mM Ca²⁺. K⁺ concentration was 0 mM for analysis of NCX and 40 mM for analysis of NCKX. Results: TGFβ1 (60 ng/ml, 24 h) significantly increased the transcript levels of NCX1, NCKX1, NCKX2 and NCKX5. Moreover, TGFβ1 (60 ng/ml, 24 h) significantly increased the activity of both, NCX and NCKX. The effect of TGFβ1 on NCX and NCKX transcript levels and activity was significantly blunted by p38 kinase inhibitor Skepinone-L (1 µM), the effect on NCX and NCKX activity further by SGK1 inhibitor GSK-650394 (10 µM) and NFκB inhibitor Wogonin (100 µM). Conclusions: TGFβ1 markedly up-regulates transcription of NCX1, NCKX1, NCKX2, and NCKX5 and thus Na⁺/Ca²⁺ exchanger activity, an effect requiring p38 kinase, SGK1 and NFκB.

Introduction

Platelets are decisive for the accomplishment of primary haemostasis and are key players in the development of acute thrombosis and thrombotic vascular occlusion [1]. Activation of platelets is followed by degranulation, exposure of phosphatidylserine, aggregation and thrombus formation [2]. All those functions are triggered by an increase of cytosolic Ca²⁺ concentration ([Ca²⁺]_i) [3, 4]. Ca²⁺ is increased by stimulation of Ca²⁺ release from intracellular stores and subsequent activation of store operated calcium entry (SOCE) [5]. SOCE is accomplished by the Ca²⁺ permeable pore forming calcium release-activated channel (CRAC) moiety Orai1 (CRACM1) and its regulator stromal interaction molecule 1 (STIM1), which senses the Ca²⁺ content of the intracellular Ca²⁺ stores [6-8].

Signaling regulating Orai1 abundance in platelets include phosphoinositide 3-kinase (PI3K) [9-12] which participates in activation of Serum- and Glucocorticoid-inducible Kinase 1 (SGK1) [13, 14], a powerful stimulator of Orai1 expression [15]. SGK1 is in part effective by phosphorylation and thus activation of IκB kinase (IKKα/β), which in turn phosphorylates the inhibitor protein IκBα resulting in nuclear translocation of nuclear factor NFκB [15, 16].

SGK1 is strongly up-regulated by transforming growth factor TGFβ [17], an effect dependent on activation of the p38 kinase [18]. TGFß1, an inhibitor of megakaryocyte maturation released from platelets following increase of cytosolic Ca²⁺ activity ([Ca²⁺]_i) [19], is thus a powerful stimulator of Orai1 and SOCE in megakaryocytes, an effect dependent on p38 kinase, SGK1 and NF-κB [20].

TGFß1 further up-regulates Na⁺/Ca²⁺ exchange [21], which accomplishes extrusion of Ca²⁺ thus decreasing [Ca²⁺]_i and contributing to duration and amplitude Ca²⁺ signals [22-25]. Ca²⁺ extrusion by Na⁺/Ca²⁺ exchangers is driven by the low cytosolic Na⁺ concentration and the potential difference across the cell membrane [22]. Ca²⁺ transport of the carrier may be reversed by decrease of the inwardly directed Na⁺ gradient across the cell membrane and/or cell membrane depolarization, which may thus lead to Ca²⁺ entry through the carrier [22, 26]. The family of Na⁺/Ca²⁺ exchangers includes 6 K⁺-dependent (NCKX) and 3 K⁺-independent (NCX) Na⁺/Ca²⁺ exchanger isoforms [27-29]. The NCKX isoforms exchange one K⁺ ion and one Ca²⁺ ion for four Na⁺ ions and the NCX isoforms exchange three Na⁺ ions for one Ca²⁺ ion [30].

The previous study did not address the NCX and NCKX isoforms regulated by TGFß1, nor the signaling involved. The present study thus explored whether TGFß1 increases the transcript levels of NCX and NCKX isoforms and elucidated the role of p38 kinase, SGK1 and NF-κB.

Materials and Methods

Cell culture of megakaryocytes

Human megakaryocytic cells (MEG01) from ATCC (American Type Culture Collection) were cultured in 10% FBS (fetal bovine serum) and 1% Penicillin/Streptomycin containing RPMI 1640 (Roswell Park Memorial Institute) medium (Gibco ThermoFischer Scientific) in humidified atmosphere at 37°C and 5% CO₂. Where indicated, TGFß1 (60 ng/ml, Sigma, Taufkirchen, Germany), p38 kinase inhibitor Skepinone-L [31] (1 µM, Merck), SGK1 inhibitor GSK-650394 (10 µM, Tocris), or NFκB inhibitor Wogonin (100 µM, Sigma) were added to the medium.

q-Real-time PCR

Total RNA was extracted in TriFast (Peqlab, Erlangen, Germany) according to the manufacturer’s instructions. After DNAse digestion reverse transcription of total RNA was performed using Transcriptor High Fidelity cDNA Synthesis Kit (Roche Diagnostics, Penzberg, Germany). Real-time polymerase chain reaction (RT-PCR) of the respective genes were set up in a total volume of 20 µl using 40 ng of cDNA, 500 nM forward and reverse primer and 2x GoTaq® qPCR Master Mix (Promega, Hilden, Germany) according to the manufacturer's protocol. Cycling conditions were as follows: initial denaturation at 95°C for 5 min, followed by 40 cycles of 95°C for 15 sec, 58°C for 15 sec and 68°C for 20 sec. For amplification the following primers were used (5`->3`orientation):

for NCX1:

fw: ACAAGAGGTATCGAGCTGGC

rev: ATGCCATTTCTCGCCTAGC

for NCKX1:

fw: TCCACGCAGAAGATGGTG

rev GTGATGGAGGGGATAGCG

for NCKX2:

fw: GAGACAGATACACAGAGCACAGG

rev: GAGAATAGTACAGATCACGCCC

for NCKX5:

fw: CTCCATCGGAGTTCC

rev: CTTCCTACCCTCCCTGGAA

for GAPDH:

fw: TGAGTACGTCGTGGAGTCCAC

rev: GTGCTAAGCAGTTGGTGGTG

Specificity of PCR products was confirmed by analysis of a melting curve. Real-time PCR amplifications were performed on a CFX96 Real-Time System (Bio-Rad) and all experiments were done in duplicate. The housekeeping gene GAPDH (Glyceraldehyd-3-phosphate-Dehydrogenase) was amplified to standardize the amount of sample RNA. Relative quantification of gene expression was achieved using the ΔCT method as described earlier [32, 33].

Ca²⁺ measurements

Fura-2 fluorescence was utilized to determine intracellular Ca²⁺ activity [34]. Cells were loaded with Fura-2/AM (2 µM, Invitrogen, Goettingen, Germany) for 20-60 min at 37°C. Cells were excited alternatively at 340 nm and 380 nm through an objective (Fluor 40×/1.30 oil) built in a fluorescence microscope (Axiovert 100, Zeiss, Oberkochen, Germany). Emitted fluorescence intensity was recorded at 505 nm. Data were acquired using specialized computer software (Metafluor, Universal Imaging, Downingtown, USA) [35].

Na⁺/Ca²⁺ exchanger activity was estimated from the changes in cytosolic Ca²⁺ activity upon replacement of extracellular Na⁺ by N-methyl-d-glucamine (NMDG). The standard Na⁺ containing solution was composed of (in mM): 130 NaCl, 0 KCl, 2 MgCl₂, 10 HEPES, 5 glucose, pH 7.4 and the Na⁺-free solution of (in mM): 90 NMDG, 0 KCl, 2 CaCl₂, 2 MgCl₂, 10 HEPES, 5 glucose, pH 7.4. For determination of NCKX activity the Na⁺ containing solution was composed of (in mM): 130 NaCl, 40 KCl, 20 TAE+, 2 MgSO₄, 10 HEPES, 5 glucose, pH 7.4 and the Na⁺-free solution of (in mM): 90 NMDG, 40 KCl, 20 TAE+, 2 CaCl₂, 2 MgCl₂, 10 HEPES, 5 glucose, pH 7.4. For quantification of Ca²⁺ entry, the slope (delta ratio/s) and peak (delta ratio) were calculated following removal of Na⁺.

Statistical analysis

Data are provided as means ± SEM, n represents the number of experiments. All data were tested for significance using paired or unpaired Student t-test and one-way ANOVA with Dunnets post-hoc test. Results with $/*(p<0.05), $$/**(p<0.01) or §§§/***(p<0.001) were considered statistically significant.

Results

The present study addressed the mechanisms involved in the stimulation of Na⁺/Ca²⁺ exchange by TGFß1. In a first series of experiments, RT-PCR was employed in order to define the NCX and NCKX isoforms involved. As illustrated in Fig. 1, a 24 hours treatment with 60 ng/ml TGFß1 was followed by a significant increase of the transcript levels encoding NCX1, NCKX1, NCKX2, and NCKX5. Thus, TGFß1 stimulates the transcription of several NCX and NCKX isoforms.

Fig. 1.

View large Download slide

TGFß1 sensitive expression of NCX1, NCKX1, NCKX2, and NCKX5 isoforms in megakaryocytes. A-D: Arithmetic means (± SEM, n = 5-11 preparations) of (A) NCX1, (B) NCKX1, (C) NCKX2, and (D) NCKX5 over GAPDH transcript levels in megakaryocytes without (white bars) and with (black bars) prior TGFß1 treatment (60 ng/ml, 24 hours). *(p<0.05), ** (p<0.01) indicates statistically significant difference from absence of TGFß1 (student’s t-test).

In order to quantify Na⁺/Ca²⁺ exchanger activity, cytosolic Ca²⁺ activity ([Ca²⁺]_i) was determined utilizing Fura-2 fluorescence. Na⁺/Ca²⁺ exchanger activity was estimated from the increase of [Ca²⁺]_i following reversal of the Na⁺/Ca²⁺ exchanger by replacing extracellular Na⁺ with NMDG⁺ and simultaneous addition of extracellular Ca²⁺. In a first series of experiments no extracellular K⁺ was added to specifically observe NCX activity. As shown in Fig. 2, pre-treatment with 60 ng/ml but not pre-treatment with 20 ng/ml or 40 ng/ml TGFß1 was followed by a marked and statistically significant increase of K⁺ independent Na⁺/Ca²⁺ exchanger activity. In a second series of experiments 40 mM extracellular K⁺ was added to observe NCKX activity. As shown in Fig. 3, again pre-treatment with 60 ng/ml but not pre-treatment with 20 ng/ml or 40 ng/ml TGFß1 was followed by a marked and statistically significant increase of K⁺ dependent Na⁺/Ca²⁺ exchanger activity.

Fig. 2.

View large Download slide

TGFß1 sensitive NCX mediated Ca²⁺ entry in megakaryocytes. A. Representative original tracings showing intracellular Ca²⁺ concentrations in Fura-2/AM loaded megakaryocytes without (open diamonds) and with prior 24 h treatment with 20 ng/ml TGFß1 (closed diamonds), 40 ng/ml TGFß1 (closed circles) or 60 ng/ml TGFß1 (closed triangles) prior to and following removal of external Na⁺ (0 Na⁺) and adding 2 mM Ca²⁺ at 0 mM K⁺. B,C. Arithmetic means (± SEM, n = 46 - 59 cells) of the peak (B) and slope (C) of the change in intracellular Ca²⁺ concentrations following removal of external Na⁺ (0 Na⁺) and adding 2 mM Ca²⁺ at 0 mM K⁺ in megakaryocytes without (white bars) and with (black bars) prior TGFß1 treatment. ** (p<0.01), *** (p<0.001) indicate statistically significant difference from untreated megakaryocytes (ANOVA).

Fig. 3.

View large Download slide

TGFß1 sensitive NCKX mediated Ca²⁺ entry in megakaryocytes. A. Representative original tracings showing intracellular Ca²⁺ concentrations in Fura-2/AM loaded megakaryocytes without (open diamonds) and with prior 24 h treatment with 20 ng/ml TGFß1 (closed diamonds), 40 ng/ml TGFß1 (closed circles) or 60 ng/ml TGFß1 (closed triangles) prior to and following removal of external Na⁺ (0 Na⁺) and adding 2 mM Ca²⁺ at 40 mM K⁺. B,C. Arithmetic means (± SEM, n = 46 - 59 cells) of the peak (B) and slope (C) of the change in intracellular Ca²⁺ concentrations following removal of external Na⁺ (0 Na⁺) and adding 2 mM Ca²⁺ at 40 mM K⁺ in megakaryocytes without (white bars) and with (black bars) prior TGFß1 treatment. *** (p<0.001) indicate statistically significant difference from untreated megakaryocytes (ANOVA).

In a further series of experiments the time course of the TGFß1 effect was elucidated. As shown in Fig. 4, pre-treatment with 60 ng/ml TGFß1 for 24 hours, but not for 6 hours or 12 hours was followed by a marked and statistically significant increase of K⁺ independent Na⁺/Ca²⁺ exchanger activity. As illustrated in Fig. 5, pre-treatment with 60 ng/ml TGFß1 for 24 hours, but not for 6 hours or 12 hours was followed by a marked and statistically significant increase of K⁺ independent Na⁺/Ca²⁺ exchanger activity.

Fig. 4.

View large Download slide

Time course of TGFß1-induced increase of NCX mediated Ca²⁺ entry in megakaryocytes. A. Representative original tracings showing intracellular Ca²⁺ concentrations in Fura-2/AM loaded megakaryocytes without (open diamonds) and with prior treatment with 60 ng/ml TGFß1 for 6 hours (closed diamonds), 12 hours (closed circles) or 24 hours (closed triangles) prior to and following removal of external Na⁺ (0 Na⁺) and adding 2 mM Ca²⁺ at 0 mM K⁺. B,C. Arithmetic means (± SEM, n = 40 - 52 cells) of the peak (B) and slope (C) of the change in intracellular Ca²⁺ concentrations following removal of external Na⁺ (0 Na⁺) and adding 2 mM Ca²⁺ at 0 mM K⁺ in megakaryocytes without (white bars) and with (black bars) prior TGFß1 (60 nM) treatment. *** (p<0.001) indicate statistically significant difference from untreated megakaryocytes (ANOVA).

Fig. 5.

View large Download slide

Time course of TGFß1-induced increase of NCKX mediated Ca²⁺ entry in megakaryocytes. A. Representative original tracings showing intracellular Ca²⁺ concentrations in Fura-2/AM loaded megakaryocytes without (open diamonds) and with prior treatment with 60 ng/ml TGFß1 for 6 hours (closed diamonds), 12 hours (closed circles) or 24 hours (closed triangles) prior to and following removal of external Na⁺ (0 Na⁺) and adding 2 mM Ca²⁺ at 40 mM K⁺. B,C. Arithmetic means (± SEM, n = 40 - 52 cells) of the peak (B) and slope (C) of the change in intracellular Ca²⁺ concentrations following removal of external Na⁺ (0 Na⁺) and adding 2 mM Ca²⁺ at 40 mM K⁺ in megakaryocytes without (white bars) and with (black bars) prior TGFß1 (60 ng/ml) treatment. *** (p<0.001) indicate statistically significant difference from untreated megakaryocytes (ANOVA).

The involvement of the p38 kinase in the up-regulation of Na⁺/Ca²⁺ exchanger transcription and activity following TGFß1 treatment of megakaryocytes was tested by application of the p38 kinase inhibitor Skepinone-L (1 µM). As shown in Fig. 6, a 24 hours treatment with 60 ng/ml TGFß1 again significantly increased the transcript levels encoding NCX1, NCKX1, NCKX2, and NCKX5. The effect of TGFß1 on the transcript levels was abrogated in the presence of Skepinone-L. The alterations of the transcript levels were paralleled by the respective alterations of Na⁺/Ca²⁺ exchanger activity. As illustrated in Fig. 7, the up-regulation of K⁺ independent Na⁺/Ca²⁺ exchanger activity by TGFß1 pretreatment was significantly blunted in the presence of p38 kinase inhibitor Skepinone-L. As shown in Fig. 8, the up-regulation of K⁺ dependent Na⁺/Ca²⁺ exchanger activity by TGFß1 pretreatment was again significantly blunted in the presence of p38 kinase inhibitor Skepinone-L.

Fig. 6.

View large Download slide

Requirement of functional p38 kinase for TGFß1 sensitive expression of NCX1, NCKX1, NCKX2, and NCKX5 isoforms in megakaryocytes. A-D: Arithmetic means (± SEM, n = 4-11 preparations) of (A) NCX1, (B) NCKX1, (C) NCKX2, and (D) NCKX5 over GAPDH transcript levels in megakaryocytes without (white bars) and with prior TGFß1 treatment (60 ng/ml, 24 hours) in the absence (black bars) and presence (grey bars) of p38 kinase inhibitor Skepinone-L (1 µM). *(p<0.05), ** (p<0.01) indicates statistically significant difference from absence of TGFß1, $ (p<0.05), $$ (p<0.01) indicates statistically significant difference from absence of Skepinone-L (student´s t-test).

Fig. 7.

View large Download slide

Requirement of functional p38 kinase for TGFß1 sensitive NCX mediated Ca²⁺ entry in megakaryocytes. A. Representative original tracings showing intracellular Ca²⁺ concentrations in Fura-2/AM loaded megakaryocytes without TGFß1 treatment (open diamonds) and with prior 24 h treatment with 60 ng/ml TGFß1 alone (closed circles) or TGFß1 with p38 kinase inhibitor Skepinone-L (1 µM, closed diamonds) prior to and following removal of external Na⁺ (0 Na⁺) and adding 2 mM Ca²⁺ at 0 mM K⁺. B,C. Arithmetic means (± SEM, n = 32 - 36 cells) of the peak (B) and slope (C) of the change in intracellular Ca²⁺ concentrations following removal of external Na⁺ (0 Na⁺) and adding 2 mM Ca²⁺ at 0 mM K⁺ in megakaryocytes without (white bars) and with prior treatment with TGFß1 alone (black bars) or with TGFß1 and p38 kinase inhibitor Skepinone-L (grey bars). *** (p<0.001) indicate statistically significant difference from untreated megakaryocytes (ANOVA), §§ (p<0.01), §§§ (p<0.001) indicate statistically significant difference from megakaryocytes treated with TGFß1 alone.

Fig. 8.

View large Download slide

Requirement of functional p38 kinase for TGFß1 sensitive NCKX mediated Ca²⁺ entry in megakaryocytes. A. Representative original tracings showing intracellular Ca²⁺ concentrations in Fura-2/AM loaded megakaryocytes without TGFß1 treatment (open diamonds) and with prior 24 h treatment with 60 ng/ml TGFß1 alone (closed circles) or TGFß1 with p38 kinase inhibitor Skepinone-L (1 µM, closed diamonds) prior to and following removal of external Na⁺ (0 Na⁺) and adding 2 mM Ca²⁺ at 40 mM K⁺. B,C. Arithmetic means (± SEM, n = 32 - 36 cells) of the peak (B) and slope (C) of the change in intracellular Ca²⁺ concentrations following removal of external Na⁺ (0 Na⁺) and adding 2 mM Ca²⁺ at 40 mM K⁺ in megakaryocytes without (white bars) and with prior treatment with TGFß1 alone (black bars) or with TGFß1 and p38 kinase inhibitor Skepinone-L (grey bars). *** (p<0.001) indicate statistically significant difference from untreated megakaryocytes (ANOVA), §§ (p<0.01) indicate statistically significant difference from megakaryocytes treated with TGFß1 alone.

The involvement of SGK1 in the up-regulation of Na⁺/Ca²⁺ exchanger activity following TGFß1 treatment of megakaryocytes was tested by application of the SGK1 inhibitor GSK-650394 (10 µM). As illustrated in Fig. 9, the up-regulation of K⁺ independent Na⁺/Ca²⁺ exchanger activity by TGFß1 pretreatment was significantly blunted in the presence of SGK1 inhibitor GSK-650394. As shown in Fig. 10, the up-regulation of K⁺ dependent Na⁺/Ca²⁺ exchanger activity by TGFß1 pretreatment was again significantly blunted in the presence of SGK1 inhibitor GSK-650394.

Fig. 9.

View large Download slide

Requirement of functional SGK1 for TGFß1 sensitive NCX mediated Ca²⁺ entry in megakaryocytes. A. Representative original tracings showing intracellular Ca²⁺ concentrations in Fura-2/AM loaded megakaryocytes without TGFß1 treatment (open diamonds) and with prior 24 h treatment with 60 ng/ml TGFß1 alone (closed circles) or TGFß1 with SGK1 inhibitor GSK-650394 (10 µM, closed diamonds) prior to and following removal of external Na⁺ (0 Na⁺) and adding 2 mM Ca²⁺ at 40 mM K⁺. B,C. Arithmetic means (± SEM, n = 34 - 36 cells) of the peak (B) and slope (C) of the change in intracellular Ca²⁺ concentrations following removal of external Na⁺ (0 Na⁺) and adding 2 mM Ca²⁺ at 40 mM K⁺ in megakaryocytes without (white bars) and with prior treatment with TGFß1 alone (black bars) or with TGFß1 and with SGK1 inhibitor GSK-650394 (10 µM) (grey bars). *** (p<0.001) indicate statistically significant difference from untreated megakaryocytes (ANOVA), §§§ (p<0.001), §§ (p<0.01) indicate statistically significant difference from megakaryocytes treated with TGFß1 alone.

Fig. 10.

View large Download slide

Requirement of functional p38 kinase for TGFß1 sensitive NCKX mediated Ca²⁺ entry in megakaryocytes. A. Representative original tracings showing intracellular Ca²⁺ concentrations in Fura-2/AM loaded megakaryocytes without TGFß1 treatment (open diamonds) and with prior 24 h treatment with 60 ng/ml TGFß1 alone (closed circles) or TGFß1 with SGK1 inhibitor GSK-650394 (10 µM, closed diamonds) prior to and following removal of external Na⁺ (0 Na⁺) and adding 2 mM Ca²⁺ at 40 mM K⁺. B,C. Arithmetic means (± SEM, n = 34 - 36 cells) of the peak (B) and slope (C) of the change in intracellular Ca²⁺ concentrations following removal of external Na⁺ (0 Na⁺) and adding 2 mM Ca²⁺ at 40 mM K⁺ in megakaryocytes without (white bars) and with prior treatment with TGFß1 alone (black bars) or with TGFß1 and with SGK1 inhibitor GSK-650394 (grey bars). *** (p<0.001) indicate statistically significant difference from untreated megakaryocytes (ANOVA), §§ (p<0.01) indicate statistically significant difference from megakaryocytes treated with TGFß1 alone.

The involvement of NFκB in the up-regulation of Na⁺/Ca²⁺ exchanger activity following TGFß1 treatment of megakaryocytes was tested by application of the NFκB inhibitor Wogonin (100 µM). As illustrated in Fig. 11, the up-regulation of K⁺ independent Na⁺/Ca²⁺ exchanger activity by TGFß1 pretreatment was significantly blunted in the presence of NFκB inhibitor Wogonin. As shown in Fig. 12, the up-regulation of K⁺ dependent Na⁺/Ca²⁺ exchanger activity by TGFß1 pretreatment was again significantly blunted in the presence of NFκB inhibitor Wogonin.

Fig. 11.

View large Download slide

Requirement of functional NF-κB for TGFß1 sensitive NCX mediated Ca²⁺ entry in megakaryocytes. A. Representative original tracings showing intracellular Ca²⁺ concentrations in Fura-2/AM loaded megakaryocytes without TGFß1 treatment (open diamonds) and with prior 24 h treatment with 60 ng/ml TGFß1 alone (closed circles) or TGFß1 with NF-κB inhibitor Wogonin (100 µM, closed squares) prior to and following removal of external Na⁺ (0 Na⁺) and adding 2 mM Ca²⁺ at 0 mM K⁺. B,C. Arithmetic means (± SEM, n = 31 - 39 cells) of the peak (B) and slope (C) of the change in intracellular Ca²⁺ concentrations following removal of external Na⁺ (0 Na⁺) and adding 2 mM Ca²⁺ at 0 mM K⁺ in megakaryocytes without (white bars) and with prior treatment with TGFß1 alone (black bars) or with TGFß1 and with NF-κB inhibitor Wogonin (100 µM) (grey bars). *** (p<0.001) indicate statistically significant difference from untreated megakaryocytes (ANOVA), §§ (p<0.01) §§§ (p<0.001) indicate statistically significant difference from megakaryocytes treated with TGFß1 alone.

Fig. 12.

View large Download slide

Requirement of functional NF-κB for TGFß1 sensitive NCKX mediated Ca²⁺ entry in megakaryocytes. A. Representative original tracings showing intracellular Ca²⁺ concentrations in Fura-2/AM loaded megakaryocytes without TGFß1 treatment (open diamonds) and with prior 24 h treatment with 60 ng/ml TGFß1 alone (closed circles) or TGFß1 with NF-κB inhibitor Wogonin (100 µM, closed squares) prior to and following removal of external Na⁺ (0 Na⁺) and adding 2 mM Ca²⁺ at 40 mM K⁺. B,C. Arithmetic means (± SEM, n = 31 - 39 cells) of the peak (B) and slope (C) of the change in intracellular Ca²⁺ concentrations following removal of external Na⁺ (0 Na⁺) and adding 2 mM Ca²⁺ at 40 mM K⁺ in megakaryocytes without (white bars) and with prior treatment with TGFß1 alone (black bars) or with TGFß1 and with NF-κB inhibitor Wogonin (grey bars). *** (p<0.001) indicate statistically significant difference from untreated megakaryocytes (ANOVA), §§ (p<0.01) indicate statistically significant difference from megakaryocytes treated with TGFß1 alone.

Discussion

The present study confirms the previous observation [21] that TGFß1 is a powerful stimulator of Na⁺/Ca²⁺ exchange in megakaryocytes. The carriers may accomplish Ca²⁺ extrusion at high intracellular Ca²⁺ concentrations and/or hyperpolarized cell membrane potential, but may mediate Ca²⁺ entry during high intracellular Na⁺ concentration and/or depolarized cell membrane [22, 36-38]. TGFß1 up-regulates both, Ca²⁺ entry via Orai1 [20] and Ca²⁺ entry or Ca²⁺ extrusion by Na⁺/Ca²⁺ exchange [21].

Simultaneous stimulation of Ca²⁺ entry via Orai1 and Ca²⁺ extrusion by Na⁺/Ca²⁺ exchangers may trigger Ca²⁺ oscillations [39] which contribute to the regulation of diverse cellular functions [25, 40-43]. Ca²⁺ oscillations are required for the entrance into the S and the M phase of the cell cycle [44, 45] and confer cell survival [46, 47]. Ca²⁺ oscillations critically depend on timely entry and timely extrusion of Ca²⁺. In the absence of Ca²⁺ extrusion Ca²⁺ entry leads to sustained increase of cytosolic Ca²⁺ activity with stimulation of apoptosis [40, 42, 48-56].

The present observations define the NCX and NCKX isoforms involved in the TGFß1-induced up-regulation of Na⁺/Ca²⁺ exchange and shed light on the signalling involved. Similar to what has been observed in the regulation of Orai1 and SOCE [20], the effect of TGFß1 is blunted or even abrogated in the presence of p38 kinase inhibitor Skepinone-L, of SGK1 inhibitor GSK-650394 and of NFκB inhibitor Wogonin. TGFß1 is thus presumably effective by upregulating p38 kinase [18] with subsequent up-regulation of SGK1 [15], which in turn activates nuclear factor NFκB [15, 16].

In addition to directly modify Ca²⁺ transport, TGFß1 may indirectly influence Na⁺/Ca²⁺ exchange by up-regulating the Na⁺/K⁺ ATPase in megakaryocytes thus enhancing the Na⁺ gradient and potential difference driving Ca²⁺ extrusion via the Na⁺/Ca²⁺ exchange [57]. The effect of TGFß1 on Na⁺/K⁺ ATPase similarly involves p38 kinase, SGK1 and NF-κB [57].

TGFß1 is produced by megakaryocytes [58, 59] and required for megakaryocyte maturation and platelet formation [19]. The growth factor stimulates expression of bone marrow stromal thrombopoietin [19], which in turn stimulates the expression of megakaryocytic TGF-beta receptors [19]. TGFß1 is thus a powerful regulator of megakaryopoiesis [19] and excessive TGFß1 expression leads to myelofibrosis [59].

Besides its putative impact on megakaryocyte proliferation, maturation and survival, activation of megakaryocytes with TGFß1 yields platelets with enhanced Orai1 dependent Ca²⁺ entry as well as NCX and NCKX dependent Ca²⁺ entry and extrusion, which presumably impacts on the platelet response to activators such as thrombin or collagen related peptide [15].

In conclusion, TGFß1 up-regulates the Na⁺/Ca²⁺ exchanger isoforms NCX1, NCKX1, NCKX2 and NCKX5, and thus does not only up-regulate store operated Ca²⁺ entry but as well Ca²⁺ extrusion by the Na⁺/Ca²⁺ exchanger isoforms. The signalling for the regulation of both, SOCE and Na⁺/Ca²⁺ exchange involves p38 kinase, SGK1 and NFκB.

Funding

This work has been supported in part by the European Union Seventh Framework Programme (FP7/2007-2013), Systems Biology to Identify Molecular Targets for Vascular Disease Treatment (SysVasc, HEALTH-2013 603288), by grants from the Deutsche Forschungsgemeinschaft (DFG) Klinische Forschergruppe KFO “Platelets-Basic Mechanisms and Translational Implications”, by grants from the Deutscher Akademischer Austauschdienst (DAAD) to T.M, by Council of Scientific & Industrial Research (CSIR-SRF) fellowship, Government of India and bi-nationally supervised PhD DAAD funded Fellowship to I.S. The work was further supported by the Open Access Publishing Fund of Tuebingen University.

The sponsor(s) had no role in study design, the collection, analysis and interpretation of data, in the writing of the report, and in the decision to submit the article for publication.

Disclosure Statement

None.

References

1.

Ruggeri ZM: Platelets in atherothrombosis. Nat Med 2002; 8:1227-1234.

2.

Varga-Szabo D, Braun A, Nieswandt B: Calcium signaling in platelets. J Thromb Haemost 2009; 7:1057-1066.

3.

Bergmeier W, Stefanini L: Novel molecules in calcium signaling in platelets. J Thromb Haemost 2009; 7:S187-190.

4.

Rink TJ, Sage SO: Calcium signaling in human platelets. Annu Rev Physiol 1990; 52:431-449.

5.

Parekh AB: Store-operated CRAC channels: function in health and disease. Nat Rev Drug Discov 2010; 9:399-410.

6.

Bergmeier W, Oh-hora M, McCarl CA, Roden RC, Bray PF, Feske S: R93W mutation in Orai1 causes impaired calcium influx in platelets. Blood 2009; 113:675-678.

7.

Braun A, Varga-Szabo D, Kleinschnitz C, Pleines I, Bender M, Austinat M, Bosl M, Stoll G, Nieswandt B: Orai1 (CRACM1) is the platelet SOC channel and essential for pathological thrombus formation. Blood 2009; 113:2056-2063.

8.

Varga-Szabo D, Braun A, Kleinschnitz C, Bender M, Pleines I, Pham M, Renne T, Stoll G, Nieswandt B: The calcium sensor STIM1 is an essential mediator of arterial thrombosis and ischemic brain infarction. J Exp Med 2008; 205:1583-1591.

9.

Chen J, De S, Damron DS, Chen WS, Hay N, Byzova TV: Impaired platelet responses to thrombin and collagen in AKT-1-deficient mice. Blood 2004; 104:1703-1710.

10.

Jackson SP, Schoenwaelder SM, Goncalves I, Nesbitt WS, Yap CL, Wright CE, Kenche V, Anderson KE, Dopheide SM, Yuan Y, Sturgeon SA, Prabaharan H, Thompson PE, Smith GD, Shepherd PR, Daniele N, Kulkarni S, Abbott B, Saylik D, Jones C, Lu L, Giuliano S, Hughan SC, Angus JA, Robertson AD, Salem HH: PI 3-kinase p110beta: a new target for antithrombotic therapy. Nat Med 2005; 11:507-514.

11.

Gilio K, Munnix IC, Mangin P, Cosemans JM, Feijge MA, van der Meijden PE, Olieslagers S, Chrzanowska-Wodnicka MB, Lillian R, Schoenwaelder S, Koyasu S, Sage SO, Jackson SP, Heemskerk JW: Non-redundant roles of phosphoinositide 3-kinase isoforms alpha and beta in glycoprotein VI-induced platelet signaling and thrombus formation. J Biol Chem 2009; 284:33750-33762.

12.

Lian L, Wang Y, Draznin J, Eslin D, Bennett JS, Poncz M, Wu D, Abrams CS: The relative role of PLCbeta and PI3Kgamma in platelet activation. Blood 2005; 106:110-117.

13.

Endo T, Kusakabe M, Sunadome K, Yamamoto T, Nishida E: The kinase SGK1 in the endoderm and mesoderm promotes ectodermal survival by down-regulating components of the death-inducing signaling complex. Sci Signal 2011; 4:ra2.

14.

Lang F, Bohmer C, Palmada M, Seebohm G, Strutz-Seebohm N, Vallon V: (Patho)physiological significance of the serum- and glucocorticoid-inducible kinase isoforms. Physiol Rev 2006; 86:1151-1178.

15.

Borst O, Schmidt EM, Munzer P, Schonberger T, Towhid ST, Elvers M, Leibrock C, Schmid E, Eylenstein A, Kuhl D, May AE, Gawaz M, Lang F: The serum- and glucocorticoid-inducible kinase 1 (SGK1) influences platelet calcium signaling and function by regulation of Orai1 expression in megakaryocytes. Blood 2012; 119:251-261.

16.

Eylenstein A, Schmidt S, Gu S, Yang W, Schmid E, Schmidt EM, Alesutan I, Szteyn K, Regel I, Shumilina E, Lang F: Transcription factor NF-kappaB regulates expression of pore-forming Ca2+ channel unit, Orai1, and its activator, STIM1, to control Ca2+ entry and affect cellular functions. J Biol Chem 2012; 287:2719-2730.

17.

Waldegger S, Klingel K, Barth P, Sauter M, Rfer ML, Kandolf R, Lang F: h-sgk serine-threonine protein kinase gene as transcriptional target of transforming growth factor beta in human intestine. Gastroenterology 1999; 116:1081-1088.

18.

Waerntges S, Klingel K, Weigert C, Fillon S, Buck M, Schleicher E, Rodemann HP, Knabbe C, Kandolf R, Lang F: Excessive transcription of the human serum and glucocorticoid dependent kinase hSGK1 in lung fibrosis. Cell Physiol Biochem 2002; 12:135-142.

19.

Sakamaki S, Hirayama Y, Matsunaga T, Kuroda H, Kusakabe T, Akiyama T, Konuma Y, Sasaki K, Tsuji N, Okamoto T, Kobune M, Kogawa K, Kato J, Takimoto R, Koyama R, Niitsu Y: Transforming growth factor-beta1 (TGF-beta1) induces thrombopoietin from bone marrow stromal cells, which stimulates the expression of TGF-beta receptor on megakaryocytes and, in turn, renders them susceptible to suppression by TGF-beta itself with high specificity. Blood 1999; 94:1961-1970.

20.

Yan J, Schmid E, Almilaji A, Shumilina E, Borst O, Laufer S, Gawaz M, Lang F: Effect of TGFbeta on calcium signaling in megakaryocytes. Biochem Biophys Res Commun 2015; 461:8-13.

21.

Almilaji A, Yan J, Hosseinzadeh Z, Schmid E, Gawaz M, Lang F: Up-Regulation of Na+/Ca2+ Exchange in Megakaryocytes Following TGFbeta1 Treatment. Cell Physiol Biochem 2016; 39:693-699.

22.

Roberts DE, Matsuda T, Bose R: Molecular and functional characterization of the human platelet Na (+)/Ca(2+) exchangers. Br J Pharmacol 2012; 165:922-936.

23.

Clapham DE: Calcium signaling. Cell 2007; 131:1047-1058.

24.

Berridge MJ: Calcium microdomains: organization and function. Cell Calcium 2006; 40:405-412

25.

Berridge MJ, Bootman MD, Roderick HL: Calcium signalling: dynamics, homeostasis and remodeling. Nat Rev Mol Cell Biol 2003; 4:517-529.

26.

Blaustein MP, Lederer WJ: Sodium/calcium exchange: its physiological implications. Physiol Rev 1999; 79:763-854.

27.

Khananshvili D: Sodium-calcium exchangers (NCX): molecular hallmarks underlying the tissue-specific and systemic functions. Pflugers Arch 2014; 466:43-60.

28.

Visser F, Lytton J: K+ -dependent Na+/Ca2+ exchangers: key contributors to Ca2+ signaling. Physiology (Bethesda) 2007; 22:185-192.

29.

Visser F, Valsecchi V, Annunziato L, Lytton J: Exchangers NCKX2, NCKX3, and NCKX4: identification of Thr-551 as a key residue in defining the apparent K(+) affinity of NCKX2. J Biol Chem 2007; 282:4453-4462.

30.

Lytton J: Na+/Ca2+ exchangers: three mammalian gene families control Ca2+ transport. Biochem J 2007; 406:365-382.

31.

Koeberle SC, Romir J, Fischer S, Koeberle A, Schattel V, Albrecht W, Grutter C, Werz O, Rauh D, Stehle T, Laufer SA: Skepinone-L is a selective p38 mitogen-activated protein kinase inhibitor. Nat Chem Biol 2012; 8:141-143.

32.

Borst O, Munzer P, Gatidis S, Schmidt EM, Schonberger T, Schmid E, Towhid ST, Stellos K, Seizer P, May AE, Lang F, Gawaz M: The inflammatory chemokine CXC motif ligand 16 triggers platelet activation and adhesion via CXC motif receptor 6-dependent phosphatidylinositide 3-kinase/Akt signaling. Circ Res 2012; 111:1297-1307.

33.

Feger M, Fajol A, Lebedeva A, Meissner A, Michael D, Voelkl J, Alesutan I, Schleicher E, Reichetzeder C, Hocher B, Qadri SM, Lang F: Effect of carbon monoxide donor CORM-2 on vitamin D3 metabolism. Kidney Blood Press Res 2013; 37:496-505.

34.

Schmid E, Bhandaru M, Nurbaeva MK, Yang W, Szteyn K, Russo A, Leibrock C, Tyan L, Pearce D, Shumilina E, Lang F: SGK3 regulates Ca(2+) entry and migration of dendritic cells. Cell Physiol Biochem 2012; 30:1423-1435.

35.

Bhavsar SK, Schmidt S, Bobbala D, Nurbaeva MK, Hosseinzadeh Z, Merches K, Fajol A, Wilmes J, Lang F: AMPKalpha1-sensitivity of Orai1 and Ca(2+) entry in T - lymphocytes. Cell Physiol Biochem 2013; 32:687-698.

36.

Pulcinelli FM, Trifiro E, Massimi I, Di Renzo L: A functional interaction between TRPC/NCKX induced by DAG plays a role in determining calcium influx independently from PKC activation. Platelets 2013; 24:554-559.

37.

Shumilina E, Nurbaeva MK, Yang W, Schmid E, Szteyn K, Russo A, Heise N, Leibrock C, Xuan NT, Faggio C, Kuro-o M, Lang F: Altered regulation of cytosolic Ca(2)(+) concentration in dendritic cells from klotho hypomorphic mice. Am J Physiol Cell Physiol 2013; 305:C70-77.

38.

Shumilina E, Xuan NT, Matzner N, Bhandaru M, Zemtsova IM, Lang F: Regulation of calcium signaling in dendritic cells by 1,25-dihydroxyvitamin D3. FASEB J 2010; 24:1989-1996.

39.

Lang F, Friedrich F, Kahn E, Woll E, Hammerer M, Waldegger S, Maly K, Grunicke H: Bradykinin-induced oscillations of cell membrane potential in cells expressing the Ha-ras oncogene. J Biol Chem 1991; 266:4938-4942.

40.

Berridge MJ, Lipp P, Bootman MD: The versatility and universality of calcium signalling. Nat Rev Mol Cell Biol 2000; 1:11-21.

41.

Lang F, Busch GL, Ritter M, Volkl H, Waldegger S, Gulbins E, Haussinger D: Functional significance of cell volume regulatory mechanisms. Physiol Rev 1998; 78:247-306.

42.

Parekh AB, Penner R: Store depletion and calcium influx. Physiol Rev 1997; 77:901-930.

43.

Berridge MJ, Bootman MD, Lipp P: Calcium–a life and death signal. Nature 1998; 395:645-648.

44.

Steinhardt RA, Alderton J: Intracellular free calcium rise triggers nuclear envelope breakdown in the sea urchin embryo. Nature 1988; 332:364-366.

45.

Taylor JT, Zeng XB, Pottle JE, Lee K, Wang AR, Yi SG, Scruggs JA, Sikka SS, Li M: Calcium signaling and T-type calcium channels in cancer cell cycling. World J Gastroenterol 2008; 14:4984-4991.

46.

Heise N, Palme D, Misovic M, Koka S, Rudner J, Lang F, Salih HR, Huber SM, Henke G: Non-selective cation channel-mediated Ca2+-entry and activation of Ca2+/calmodulin-dependent kinase II contribute to G2/M cell cycle arrest and survival of irradiated leukemia cells. Cell Physiol Biochem 2010; 26:597-608.

47.

Parkash J, Asotra K: Calcium wave signaling in cancer cells. Life Sci 2010; 87:587-595.

48.

Towhid ST, Schmidt EM, Tolios A, Munzer P, Schmid E, Borst O, Gawaz M, Stegmann E, Lang F: Stimulation of platelet death by vancomycin. Cell Physiol Biochem 2013; 31:102-112.

49.

Benavides Damm T, Egli M: Calcium's role in mechanotransduction during muscle development. Cell Physiol Biochem 2014; 33:249-272.

50.

Fang KM, Chang WL, Wang SM, Su MJ, Wu ML: Arachidonic acid induces both Na+ and Ca2+ entry resulting in apoptosis. J Neurochem 2008; 104:1177-1189.

51.

Green DR, Reed JC: Mitochondria and apoptosis. Science 1998; 281:1309-1312.

52.

Lang F, Hoffmann EK: Role of ion transport in control of apoptotic cell death. Compr Physiol 2012; 2:2037-2061.

53.

Liu XH, Kirschenbaum A, Yu K, Yao S, Levine AC: Cyclooxygenase-2 suppresses hypoxia-induced apoptosis via a combination of direct and indirect inhibition of p53 activity in a human prostate cancer cell line. J Biol Chem 2005; 280:3817-3823.

54.

Shaik N, Zbidah M, Lang F: Inhibition of Ca(2+) entry and suicidal erythrocyte death by naringin. Cell Physiol Biochem 2012; 30:678-686.

55.

Spassova MA, Soboloff J, He LP, Hewavitharana T, Xu W, Venkatachalam K, van Rossum DB, Patterson RL, Gill DL: Calcium entry mediated by SOCs and TRP channels: variations and enigma. Biochim Biophys Acta 2004; 1742:9-20.

56.

Svoboda N, Pruetting S, Grissmer S, Kerschbaum HH: cAMP-dependent chloride conductance evokes ammonia-induced blebbing in the microglial cell line, BV-2. Cell Physiol Biochem 2009; 24:53-64.

57.

Hosseinzadeh Z, Schmid E, Shumilina E, Laufer S, Borst O, Gawaz M, Lang F: Effect of TGFbeta on Na+/K+ ATPase activity in megakaryocytes. Biochem Biophys Res Commun 2014; 452:537-541.

58.

Bock O, Loch G, Schade U, von Wasielewski R, Schlue J, Kreipe H: Aberrant expression of transforming growth factor beta-1 (TGF beta-1) per se does not discriminate fibrotic from non-fibrotic chronic myeloproliferative disorders. J Pathol 2005; 205:548-557.

59.

Ponce CC, de Lourdes FCM, Ihara SS, Silva MR: The relationship of the active and latent forms of TGF-beta1 with marrow fibrosis in essential thrombocythemia and primary myelofibrosis. Med Oncol 2012; 29:2337-2344.

2017

Open Access License / Drug Dosage / Disclaimer

This article is licensed under the Creative Commons Attribution-NonCommercial-NoDerivatives 4.0 International License (CC BY-NC-ND). Usage and distribution for commercial purposes as well as any distribution of modified material requires written permission. Drug Dosage: The authors and the publisher have exerted every effort to ensure that drug selection and dosage set forth in this text are in accord with current recommendations and practice at the time of publication. However, in view of ongoing research, changes in government regulations, and the constant flow of information relating to drug therapy and drug reactions, the reader is urged to check the package insert for each drug for any changes in indications and dosage and for added warnings and precautions. This is particularly important when the recommended agent is a new and/or infrequently employed drug. Disclaimer: The statements, opinions and data contained in this publication are solely those of the individual authors and contributors and not of the publishers and the editor(s). The appearance of advertisements or/and product references in the publication is not a warranty, endorsement, or approval of the products or services advertised or of their effectiveness, quality or safety. The publisher and the editor(s) disclaim responsibility for any injury to persons or property resulting from any ideas, methods, instructions or products referred to in the content or advertisements.

P38 Kinase, SGK1 and NF-κB Dependent Up-Regulation of Na⁺/Ca²⁺ Exchanger Expression and Activity Following TGFß1 Treatment of Megakaryocytes

Abstract

Introduction

Materials and Methods

Cell culture of megakaryocytes

q-Real-time PCR

Ca²⁺ measurements

Statistical analysis

Results

Discussion

Funding

Disclosure Statement

References

Citing articles via

INFORMATION

ABOUT US

SERVICES FOR

Karger International

P38 Kinase, SGK1 and NF-κB Dependent Up-Regulation of Na+/Ca2+ Exchanger Expression and Activity Following TGFß1 Treatment of Megakaryocytes

Abstract

Introduction

Materials and Methods

Cell culture of megakaryocytes

q-Real-time PCR

Ca2+ measurements

Statistical analysis

Results

Discussion

Funding

Disclosure Statement

References

Citing articles via

Suggested Reading

This Feature Is Available To Subscribers Only

P38 Kinase, SGK1 and NF-κB Dependent Up-Regulation of Na⁺/Ca²⁺ Exchanger Expression and Activity Following TGFß1 Treatment of Megakaryocytes

Ca²⁺ measurements