Background: A disintegrin and metalloproteinase 17 (ADAM17) has been confirmed to play a significant role in the pathogenesis of sepsis. However, little is known about the clinical relevance of ADAM17 polymorphisms to sepsis onset and development. Methods: This study analyzed the associations of five ADAM17 promoter polymorphisms (rs55790676, rs12692386, rs11684747, rs1524668 and rs11689958) with sepsis (370 sepsis cases and 400 controls). Genotyping was performed using pyrosequencing and polymerase chain reaction-length polymorphism method. The ADAM17 expression was measured using the real-time PCR method and the concentrations of related cytokines were detected using enzyme-linked immunosorbent assay. Results: No associations were observed between these polymorphisms and sepsis susceptibility, while the rs12692386GA/GG genotypes were overrepresented among the patients with severe sepsis (P=0.002) or septic shock (P=0.0147) compared to those with sepsis subtype, suggesting a susceptible role of rs12692386A>G in the progression of sepsis. Moreover, ADAM17 expression was increased in the sepsis patients with the rs12692386GA/GG genotypes, accompanied by up-regulation of expression of the ADAM17 substrates (TNF-α, IL-6R and CX3CL1) and pro-inflammatory cytokines (IL-1β and IL-6). Conclusion: The present study has provided potentially valuable clinical evidence that the ADAM17 rs12692386 polymorphism is a functional variant that might be used as a relevant risk estimate for the progression of sepsis.

Sepsis is a systemic inflammatory response of the immune system to infection. Despite progress in the development of antibiotics and other supportive care therapies, sepsis-related morbidity and mortality remain distressingly high in intensive care units (ICUs) [1]. Genetic testing has been proposed as a strategy to identify septic patients with a poor prognosis. To date, increasing evidence demonstrates that many genetic variations associated with systemic inflammatory response may contribute to the occurrence and progression of sepsis [2,3,4,5,6]. The development of the genetic sequence and gene expression analysis may be beneficial to genetically tailored diagnostic and interventional treatment, which will improve the outcomes of critically ill patients.

The ADAM (a disintegrin and metalloprotease) family includes the transmembrane metzinkin-proteases that shed many membrane proteins, which are crucial for various biological processes, such as inflammation, migration and immunity [7,8,9,10]. ADAM17, also recognized as tumor necrosis factor alpha-converting enzyme (TACE), is responsible for the shedding of over 75 substrates including TNF-α, CX3CL1 and ICAM-1, which mediate various inflammation-promoting biological activities [11,12,13,14,15,16]. Numerous lines of evidence indicate that ADAM17 expression and activity is increased in patient with sepsis, and the genomic deletion of ADAM17 contributes to a decreased inflammatory reaction and offers strong protection from sepsis in mice [17,18,19,20]. The inhibition or the specific antagonist of ADAM17 decreases the inflammatory response in the endotoxaemia mice and confers a survival benefit to mice following sepsis [21,22]. Other studies have shown that activation of ADAM17 leads to the shedding of endothelial protein C receptor, ultimately contributing to sepsis-induced coagulation [23,24]. These lines of evidence demonstrate a significant role of ADAM17 in the pathomechanism and development of sepsis.

The gene of ADAM17/TACE has been located on chromosome 2 and contains 19 exons spanning 55 kb. Several genetic variations of ADAM17 have been demonstrated to be involved in various inflammation-related diseases, such as Kawasaki disease, obesity, Alzheimer's disease and ischemic stroke [25,26,27,28]. A recent study has demonstrated that two functional genetic variations of ADAM17, C-154A and Ser747Leu, contribute to high serum concentration of TNF-α and increased susceptibility to cardiovascular death [29]. Another study has revealed that the ADAM17 promoter region might contain important regulatory elements, spanning from approximately -600bp to the start codon, and a polymorphism at position -25 (T/G) has been shown to be responsible for variation in ADAM17 expression [30]. The rs12692386 A>G, an ADAM17 promoter polymorphism, is also demonstrated to be a functional polymorphism that contributes to the up-regulation of ADAM17 gene expression and increased risk of abdominal aortic aneurysm [31].

To date, numerous of studies have demonstrated that several functional genetic variations in the genes encoding RAGE, ADAM10 and TNF-α may influence the risk and development of sepsis [32,33,34,35]. However, to the best of our knowledge, the genetic variations of ADAM17 have not been determined in patients with sepsis, adequately. Therefore, we conduct this study to assess the clinical relevance of the five variations (rs55790676, rs12692386, rs11684747, rs1524668 and rs11689958) within the promoter region of ADAM17 to sepsis susceptibility in the Chinese Han population. Moreover, the ADAM17 mRNA expression level and the plasma concentrations of its downstream substrates (TNF-α, CX3CL1 and IL-6R) and pro-inflammatory cytokines were also evaluated to determine whether these polymorphisms were associated with the expression levels of these cytokines.

Study population

A total of 370 sepsis cases (mean age: 59.09 ± 16.77 years; 28.6% female) were consecutively admitted to ICU in the Affiliated Hospital of Guangdong Medical University between February 2013 and April 2016. Patients were excluded from this study if they had preexisting cancer, ACI, HIV, blood or autoimmune diseases. The peripheral blood were collected from the patients as soon as the diagnosis of sepsis was made, defined on the basis of the International Sepsis Definitions Conference [36,37]. The clinical variables collected from each patient were as follows: age, sex, dysfunctional organs, source of infection, blood microbiological cultures, and Acute Physiology and Chronic Health Evaluation (APACHE) II score [38]. As a control group, 400 healthy controls (mean age: 57.47 ± 13.71 years; 32.3% female) without a history of sepsis, cancer, autoimmune diseases and other inflammation-related diseases were enrolled from the Medical Examination Center in this hospital at the same period time. All the 370 sepsis cases and 400 controls were from the Chinese Han population and were older than 18 years. This study was approved by the Ethics Committee of First Affiliated Hospital of Guangdong Medical University, and the informed consent was obtained from all the patients and the volunteers.

The isolation of DNA and genotyping

The peripheral blood specimens of the 770 subjects were collected, and the genomic DNA was extracted from the whole blood using the TIANamp Blood DNA Kit (Tiangen Biotech Co., Ltd., Beijing, China) following the manufacturer's guidelines. Five SNPs (rs55790676, rs12692386, rs11684747, rs1524668 and rs11689958) within the promoter region of ADAM17 were selected according to our previous reports [28,31]. The five ADAM17 genetic variants were genotyped by using the SNaPshot Multiplex Kit (Genesky Biotechnologies, Inc., Shanghai, China). The primers used in this study were as follows: rs12692386F, 5' GGCCTAGCCCCTCAATCCTCTT 3'; rs12692386R, 5' GCTGAGCCGGCCTTTGGTAAC 3'; rs55790676F, 5' GGGGTTTCGGAAAACTGCTCAC 3'; rs55790676R, 5' TTTGGTAACGCCACCTGCACTT 3'; rs1524668-rs11689958-rs11684747R, 5' GGTGGTTTGCCGCAGTAAAATATCA 3'; rs1524668-rs11689958-rs11684747F, 5' GCACTGTACAAGAGCTGTTGGGGATA 3'. The multiplex SBE reactions (10µL final volume) contained 5µL SNaPshot Multiplex Kit (ABI), 2µL template DNA containing the multiplex PCR products, 2µL ddH2O, and 1µL primer mix. SNaPshot response procedures: (1) 95°C for 2 minutes (initial denaturation); (2) 94°C for 20s (11 cycles, denaturation); (3) 65°C for 40s (annealing); (4) 72°C for 90s (extension). Following amplification and purification, extension products were purified by incubation with 1U of the shrimp alkaline phosphatase (Takara, Otsu, shiga, Japan) at 37°C for 1h and 75°C for 15 minutes to inactivate the enzyme. In addition, 0.5µL of the purified products were mixed with Lizl20 Size Standard (0.5µL) and Hi-Di formamide (9µL) and were incubated at 95°C for 5 minutes. The final products were added into the ABI Prism 3730XL genetic sequence analyzer (Applied Biosystems, Foster City, CA, USA), and the GeneMapper 4.1 (Applied Biosystems, Foster City, CA, USA) was used to analyze the final data. All the 770 subjects were genotyped for the five promoter polymorphisms of ADAM17 successfully. Based on the power analysis at the 0.05 significance level, this study exhibited 74.5% power for rs55790676, 100.0% power for rs12692386, 74.5% power for rs11684747, 99.9% power for rs1524668 and 74.5% power for rs11689958 to test a genotype relative risk with an odds ratio of 2.0.

Mononuclear cells isolation, RNA extraction and real-time PCR

We further selected 160 subjects (80 cases and 80 controls) from the total 770 subjects in this study randomly for the isolation of peripheral blood mononuclear cells (PBMCs). Among the 160 selected subjects, 77 cases and 76 controls carried the rs55790676 GG genotype, 52 cases and 45 controls carried the rs12692386 AA genotype, 77 cases and 76 controls carried the rs11684747 AA genotype, 65 cases and 65 controls carried the rs1524668 AA genotype, 77 cases and 76 controls carried the rs11689958 GG genotype. The PBMCs were isolated by using the density gradient centrifugation method with LymphoprepTM (Axis-Shield PoCAS, Oslo, Norway). RNA was extracted from PBMCs using the RNAprep Pure Blood Kit (Sangon Biotech, Shanghai, China), then transcribed into cDNA via the cDNA Synthesis Kit RevertAid (Thermo) following the manufacturer's guidelines. The ADAM17 mRNA expression levels were detected by using the quantitative real-time PCR with the method of SYBR Green (Takara). The sequences of the sense and antisense primers were as follows: ADAM17: 5' CTGTGGTGCAAAAGCAGAAA 3' and 5' TGCCAAATGCCTCATATTCA 3'; GAPDH: 5' TCCTACCCCCAATGTATCCG 3' and 5' CCTTTAGTGGG -CCCTCGG 3'. The cycling conditions were 95°C for 5 minutes, and 40 cycles of 95°C for 5 seconds, 58°C for 20 seconds and 72°C for 10 seconds. The ADAM17 mRNA expression was normalized to that of glyceraldehyde-3-phosphate dehydrogenase (GAPDH), calculated by the 2-ΔΔCt method.

Measurement of the serum concentrations of related cytokines

The peripheral blood specimens were collected from the selected 80 sepsis cases and 80 controls in EDTA-containing tubes and the serum was separated and stored at -20°C. The serum concentrations of TNF-α, CX3CL1, IL-6R, IL-1β and IL-6 were detected by using each specific enzyme-linked immunosorbent assay (ELISA) kits (TianGen Biotech, Beijing, China). The minimum detectable concentrations were 1 pg/ml for TNF-α, 1 pg/ml for IL-6R, 0.1 ng/ml for CX3CL1, 1 pg/mL for IL-1β and 1 pg/mL for IL-6.

Statistical analyses

The GraphPad Prism 4.0 (GraphPad Software Inc., San Diego, CA, USA) and SPSS version 19.0 (IBM, NY, USA) were used to conduct the statistical analyses. Student's t-test, Mann-Whitney U-test, ANOVA, Chi squared or Fisher's exact test were used to analyze the differences in variables as appropriate. The Hardy-Weinberg equilibrium (HWE) was used to assess the deviation of the allele or genotype frequency. The Haploview software (version 4.2; http://www.broad.mit.edu/mpg/haploview/) was used to construct a linkage disequilibrium (LD) map in order to define the haplotype blocks. All data were expressed as the mean ± standard error of the mean (SEM) or as percentage frequencies. The criterion for significance was set at p < 0.05 for all the tests.

Clinical characteristics

The clinical parameters of the subjects (370 sepsis cases and 400 controls) were presented in Table 1. The mean ages of the sepsis cases and controls were 59.09 (± 16.77 years) and 57.47 years (± 13.71 years), respectively. There were no significant differences in age or sex distributions between the sepsis cases and controls. Lung tract (66.2%), abdominal (23.5%), and bloodstream infections (10.3%) were the most frequent infections in terms of location. Gram-negative (34.9%) and fungal infections(22.4%) were the primary infection types, while polymicrobialinfection accounted for 14.1%. The main pathogens bacteria identified in the present study were Acinetobacter baumannii (24.3%), Escherichia coli (10.3%), Pseudomonas aeruginosa (9.7%) and Staphylococcus aureus (7.8%). The sepsis cases consisted of 59 sepsis subtype (15.9%), 183 severe sepsis (49.5%) and 128 septic shock (34.6%). The 28-day ICU mortality rate was 15.7% in this study.

Table 1

Clinical characteristics of sepsis cases and healthy controls. N.A: not applicable; APACHE II: Acute Physiology and Chronic Health Evaluation II; Continuous data are expressed as the mean ± SD

Clinical characteristics of sepsis cases and healthy controls. N.A: not applicable; APACHE II: Acute Physiology and Chronic Health Evaluation II; Continuous data are expressed as the mean ± SD
Clinical characteristics of sepsis cases and healthy controls. N.A: not applicable; APACHE II: Acute Physiology and Chronic Health Evaluation II; Continuous data are expressed as the mean ± SD

The effect of ADAM17 genetic variations on the susceptibility to sepsis

The genotype/allele frequency distributions for the five polymorphisms (rs55790676, rs12692386, rs11684747, rs1524668 and rs11689958) within the promoter region of ADAM17 in sepsis cases and controls were showed in Table 2. No deviations from Hardy-Weinberg equilibrium were found for any of the five studied polymorphisms in the sepsis subjects and control subjects (all P>0.05, data not shown). No statistically significant differences were observed between the sepsis cases and controls concerning the genotype/allele frequencies of the five ADAM17 polymorphisms (all P>0.05, Table 2), suggesting that these polymorphisms may not affect susceptibility to sepsis. To further identify whether haplotypes of ADAM17 were correlated with sepsis, we created an LD map (Fig. 1) by using the Haploview software, and the haplotype frequencies of the five ADAM17 polymorphisms were evaluated and compared between the sepsis cases and controls. However, no statistically significant differences were detected (Table 3).

Table 2

Frequencies of the ADAM17 genotypes and alleles in the sepsis patients and controls. *False discovery rate-adjusted P-value for multiple hypotheses testing using the Benjamin- Hochberg method

Frequencies of the ADAM17 genotypes and alleles in the sepsis patients and controls. *False discovery rate-adjusted P-value for multiple hypotheses testing using the Benjamin- Hochberg method
Frequencies of the ADAM17 genotypes and alleles in the sepsis patients and controls. *False discovery rate-adjusted P-value for multiple hypotheses testing using the Benjamin- Hochberg method
Table 3

Haplotype frequencies of the ADAM17 gene polymorphisms in sepsis patients and healthy controls. Alleles in haplotype were presented in order of polymorphisms rs55790676, rs12692386, rs11684747, rs1524668 and rs11689958

Haplotype frequencies of the ADAM17 gene polymorphisms in sepsis patients and healthy controls. Alleles in haplotype were presented in order of polymorphisms rs55790676, rs12692386, rs11684747, rs1524668 and rs11689958
Haplotype frequencies of the ADAM17 gene polymorphisms in sepsis patients and healthy controls. Alleles in haplotype were presented in order of polymorphisms rs55790676, rs12692386, rs11684747, rs1524668 and rs11689958
Fig. 1

The linkage disequilibrium (LD) block structure consisted of the five ADAM17 polymorphisms. (A) Gene map and the five polymorphisms located in the promoter region of ADAM17 gene. (B) Pairwise linkage disequilibrium (LD) among the five promoter polymorphisms of ADAM17. D' values are indicated in percentages within squares in the LD plot, with solid blocks without numbers indicating D'=1 (100%) for the corresponding pair of variants. This locus is identified as one block, and the plot is generated using Haploview program, version 4.2.

Fig. 1

The linkage disequilibrium (LD) block structure consisted of the five ADAM17 polymorphisms. (A) Gene map and the five polymorphisms located in the promoter region of ADAM17 gene. (B) Pairwise linkage disequilibrium (LD) among the five promoter polymorphisms of ADAM17. D' values are indicated in percentages within squares in the LD plot, with solid blocks without numbers indicating D'=1 (100%) for the corresponding pair of variants. This locus is identified as one block, and the plot is generated using Haploview program, version 4.2.

Close modal

Genotype and allele frequency distributions among sepsis subtypes

We further separated the 370 sepsis cases into three subgroups by the severity of sepsis in order to evaluate the associations of the five ADAM17 promoter polymorphisms with the progression of sepsis (Table 4). Our data suggested that the genotype/allele frequencies of the rs12692386 in the sepsis subgroup significantly differed from that in the severe sepsis subgroup (P=0.0020 for genotype, and P=0.0063 for allele) and in the septic shock subgroup (P=0.0147 for genotype, and P=0.0274 for allele, Table 4). The GA/GG genotypes and G allele of the ADAM17 rs12692386 polymorphism were observed to be overrepresented among the cases with severe sepsis/septic shock subtypes compare to those with sepsis subtype, suggesting a susceptible role of rs12692386 A>G in the progression of sepsis. However, no significant differences were found among the three subgroups of sepsis concerning the genotype/allele frequencies of the other four ADAM17 genetic variations (all P>0.05), suggesting that these polymorphisms (rs55790676, rs11684747, rs1524668 and rs11689958) may not affect the development of sepsis. We also divided the cases into three subgroups by the number of organ-dysfunction and two subgroups by the patients' 28-day mortality, statistically significant differences were observed between one organ-dysfunction subgroup and three or more organs-dysfunction subgroup (P=0.014, Table 5), and between the 28-day surviving and non-surviving patients (P=0.020, Table 6) concerning the rs12692386 genotype frequencies.

Table 4

Genotype and allele frequencies distribution in the different sepsis status. P1: sepsis subgroup versus severe sepsis group; P2: sepsis group versus septic shock group; P3: sepsis group versus severe sepsis/septic shock groups. *False discovery rate-adjusted P-value for multiple hypotheses testing using the Benjamin-Hochberg method

Genotype and allele frequencies distribution in the different sepsis status. P1: sepsis subgroup versus severe sepsis group; P2: sepsis group versus septic shock group; P3: sepsis group versus severe sepsis/septic shock groups. *False discovery rate-adjusted P-value for multiple hypotheses testing using the Benjamin-Hochberg method
Genotype and allele frequencies distribution in the different sepsis status. P1: sepsis subgroup versus severe sepsis group; P2: sepsis group versus septic shock group; P3: sepsis group versus severe sepsis/septic shock groups. *False discovery rate-adjusted P-value for multiple hypotheses testing using the Benjamin-Hochberg method
Table 5

Genotype and allele frequencies distribution in the different number of organs dysfunction. P1: the subgroup of one organ dysfunction versus the subgroup of two organs dysfunction; P2: the subgroup of one organ dysfunction versus the subgroup of three or more organs dysfunction; P3: the subgroup of two organs dysfunction versus the subgroup of three or more organs dysfunction. *False discovery rate-adjusted P-value for multiple hypotheses testing using the Benjamin-Hochberg method

Genotype and allele frequencies distribution in the different number of organs dysfunction. P1: the subgroup of one organ dysfunction versus the subgroup of two organs dysfunction; P2: the subgroup of one organ dysfunction versus the subgroup of three or more organs dysfunction; P3: the subgroup of two organs dysfunction versus the subgroup of three or more organs dysfunction. *False discovery rate-adjusted P-value for multiple hypotheses testing using the Benjamin-Hochberg method
Genotype and allele frequencies distribution in the different number of organs dysfunction. P1: the subgroup of one organ dysfunction versus the subgroup of two organs dysfunction; P2: the subgroup of one organ dysfunction versus the subgroup of three or more organs dysfunction; P3: the subgroup of two organs dysfunction versus the subgroup of three or more organs dysfunction. *False discovery rate-adjusted P-value for multiple hypotheses testing using the Benjamin-Hochberg method
Table 6

Genotype and allele frequencies distribution between 28-day surviving and non-surviving sepsis patients. *False discovery rate-adjusted P-value for multiple hypotheses testing using the Benjamin-Hochberg method

Genotype and allele frequencies distribution between 28-day surviving and non-surviving sepsis patients. *False discovery rate-adjusted P-value for multiple hypotheses testing using the Benjamin-Hochberg method
Genotype and allele frequencies distribution between 28-day surviving and non-surviving sepsis patients. *False discovery rate-adjusted P-value for multiple hypotheses testing using the Benjamin-Hochberg method

The effect of ADAM17 genetic variations on the expression level of ADAM17

We also performed a comparative analysis to assess differences in ADAM17 mRNA expression between 80 sepsis cases and 80 controls. Significantly higher expression level of ADAM17 was observed in the sepsis cases compare to the controls (P<0.0001, Fig. 2A). When the sepsis cases were stratified into three subgroups according to the aggravation of sepsis, the expression level of ADAM17 was significantly increased in severe sepsis/septic shock subgroups than in sepsis subgroup (P=0.008 for severe sepsis subgroup, and P=0.027 for septic shock subgroup, Fig. 2B). We further stratified the sepsis cases by the genotypes of the five promoter polymorphisms of ADAM17. As shown in Figure 2C, the expression level of ADAM17 was significantly higher in carriers of the rs12692386 GA/GG genotypes compare to those with the AA genotype in the sepsis cases (P=0.016, Fig. 2C), while differential expression of ADAM17 was not detected between the healthy controls with these genotypes. In addition, no significant differences in ADAM17 mRNA expression were detected among the different genotypes of the other ADAM17 polymorphisms in the sepsis patients or controls (Fig. 2D, E, F, G).

Fig. 2

Expression levels of ADAM17 in sepsis patients and healthy controls (A). Expression levels of ADAM17 in sepsis, severe sepsis and septic shock subgroups (B); the genotype distribution between rs12692386 and the expression levels of ADAM17 in sepsis patients and healthy controls (C); the genotype distribution between rs55790676 and the expression levels of ADAM17 (D); the genotype distribution between rs11684747 and the expression levels of ADAM17 (E); the genotype distribution between rs1524668 and the expression levels of ADAM17 (F); the genotype distribution between rs11689958 and the expression levels of ADAM17 (G); the horizontal line represents the mean expression levels of ADAM17 with each group. * P <0.05; ** P <0.01; *** P <0.001.

Fig. 2

Expression levels of ADAM17 in sepsis patients and healthy controls (A). Expression levels of ADAM17 in sepsis, severe sepsis and septic shock subgroups (B); the genotype distribution between rs12692386 and the expression levels of ADAM17 in sepsis patients and healthy controls (C); the genotype distribution between rs55790676 and the expression levels of ADAM17 (D); the genotype distribution between rs11684747 and the expression levels of ADAM17 (E); the genotype distribution between rs1524668 and the expression levels of ADAM17 (F); the genotype distribution between rs11689958 and the expression levels of ADAM17 (G); the horizontal line represents the mean expression levels of ADAM17 with each group. * P <0.05; ** P <0.01; *** P <0.001.

Close modal

The effect of ADAM17 genetic variations on the serum concentrations of related cytokines

Another comparative analysis was performed to assess differences in the serum concentrations of ADAM17 substrates and pro-inflammatory cytokines between 80 sepsis cases and 80 controls. Significantly higher serum concentrations of TNF-α, IL-6R, CX3CL1, IL-1β and IL-6 were observed in the sepsis cases compare to the controls (Fig. 3A-E). When the sepsis cases were stratified into three subgroups according to the aggravation of sepsis, the serum concentrations of TNF-α, IL-6R, CX3CL1, IL-1β and IL-6 were significantly higher in severe sepsis/septic shock subgroups than in sepsis subgroup (Fig. 3F,G,H,I,J). We further analyzed the influences of the ADAM17 genetic variations on the serum concentrations of these cytokines. Our results showed that the ADAM17 rs12692386 GA/GG genotype carriers exhibited significantly higher serum concentrations of TNF-α, IL-6R, CX3CL1, IL-1β and IL-6 compared with the rs12692386 AA genotype carriers among the sepsis patients (Fig. 3K,L,M,N,O). With regard to the other ADAM17 polymorphisms, no significant differences in the serum concentrations of TNF-α, IL-6R, CX3CL1, IL-1β and IL-6 were detected among the different genotypes in sepsis cases or healthy controls (all P>0.05, Fig. 4).

Fig. 3

Concentrations of TNF-α (A), IL-6R (B), CX3CL1 (C), IL-1β (D) and IL-6 (E) between the sepsis patients and healthy controls, and the concentrations of TNF-α (F), IL-6R (G), CX3CL1 (H), IL-1β (I) and IL-6 (J) between the sepsis, severe sepsis, septic shock and severe sepsis/septic shock subgroups, and the genotype distribution between rs12692386 and the concentrations of TNF-α (K), IL-6R (L), CX3CL1 (M), IL-1β (N) and IL-6 (O) in the sepsis patients and controls. The horizontal line represents the mean concentrations of the related cytokines with each group. * P <0.05; ** P <0.01; *** P <0.001.

Fig. 3

Concentrations of TNF-α (A), IL-6R (B), CX3CL1 (C), IL-1β (D) and IL-6 (E) between the sepsis patients and healthy controls, and the concentrations of TNF-α (F), IL-6R (G), CX3CL1 (H), IL-1β (I) and IL-6 (J) between the sepsis, severe sepsis, septic shock and severe sepsis/septic shock subgroups, and the genotype distribution between rs12692386 and the concentrations of TNF-α (K), IL-6R (L), CX3CL1 (M), IL-1β (N) and IL-6 (O) in the sepsis patients and controls. The horizontal line represents the mean concentrations of the related cytokines with each group. * P <0.05; ** P <0.01; *** P <0.001.

Close modal
Fig. 4

The genotype distribution between rs55790676 and the concentrations of TNF-α (A), IL-6R (B), CX3CL1 (C), IL-1β (D) and IL-6 (E); the genotype distribution between rs1524668 and the concentrations of TNF-α (F), IL-6R (G), CX3CL1 (H), IL-1β (I) and IL-6 (J); the genotype distribution between rs11684747 and the concentrations of TNF-α (K), IL-6R (L), CX3CL1 (M), IL-1β (N) and IL-6 (O); the genotype distribution between rs11689958 and the concentrations of TNF-α (P), IL-6R (Q), CX3CL1 (R), IL-1β (S) and IL-6 (T). The horizontal line represents the mean concentrations of the related cytokines with each group. *P <0.05; **P <0.01; ***P <0.001.

Fig. 4

The genotype distribution between rs55790676 and the concentrations of TNF-α (A), IL-6R (B), CX3CL1 (C), IL-1β (D) and IL-6 (E); the genotype distribution between rs1524668 and the concentrations of TNF-α (F), IL-6R (G), CX3CL1 (H), IL-1β (I) and IL-6 (J); the genotype distribution between rs11684747 and the concentrations of TNF-α (K), IL-6R (L), CX3CL1 (M), IL-1β (N) and IL-6 (O); the genotype distribution between rs11689958 and the concentrations of TNF-α (P), IL-6R (Q), CX3CL1 (R), IL-1β (S) and IL-6 (T). The horizontal line represents the mean concentrations of the related cytokines with each group. *P <0.05; **P <0.01; ***P <0.001.

Close modal

Accumulating evidence has confirmed the significant role of ADAM17 in the body inflammatory and commune response that may contribute to the development of sepsis [11,12,13,14,15,16,17,18,19,20,21,22,23,24]. Many genetic researches demonstrated that several functional single nucleotide polymorphisms (SNPs) within the ADAM17 gene are associated with differences in immune inflammatory response and disease outcomes [25,26,27,28,29,30,31]. To the best of our knowledge, this present study was the first to analyze the clinical relevance of the five polymorphisms (rs55790676, rs12692386, rs11684747, rs1524668 and rs11689958) within the promoter region of ADAM17 to the susceptibility and progression of sepsis. Our data showed that the expression level of ADAM17 was increased in the sepsis cases than in the controls, and that it increased with the aggravation of sepsis; in addition, ADAM17 expression was found to be significantly higher in carriers of the rs12692386 GA/GG genotypes compare to those with the AA genotype among the sepsis cases, suggesting that ADAM17 rs12692386 might be a potentially functional polymorphism. Although our initial results showed no significant differences in sepsis susceptibility among the five ADAM17 promoter polymorphisms, further stratification suggested a susceptible role of rs12692386 A>G in the progression of sepsis. Moreover, a significant difference in the genotype/allele frequencies of rs12692386 was found between the 28-day surviving and non-surviving patients, suggesting that AA genotype and A allele of rs12692386 acted as a protective factor in the survivors of sepsis. However, the other four ADAM17 polymorphisms were not observed to be significantly related to the expression level of ADAM17 and the progression of sepsis.

Several lines of evidence indicate that several promoter polymorphisms of ADAM17 influence the expression level of ADAM17 and that they are associated with various inflammatory diseases. A recent study has revealed that the rs11684747 polymorphism has a potential allele-specific binding site for the hepatocyte nuclear factor-1 alpha (HNF1A/B) transcription factor, which is associated with the insulin sensitivity and progression of diabetes [26,39]. Our previous studies have shown that the ADAM17 rs1524668 A>C increases the susceptibility to PACI-type stroke and that the rs12692386 GA/GG genotypes of ADAM17 are linked to high ADAM17 mRNA expression and increase susceptibility to human abdominal aortic aneurysm [28,31]. We speculate that transcriptional enhancers and other regulatory elements in the promoter regions may play various regulatory roles in the gene transcription. Furthermore, computational analysis of rs12692386 via MAPPER has revealed the presence of a allele-specific binding site for the upstream stimulatory factor (USF) transcription factor [40]. The rs12692386 A>G polymorphism within the promoter region of ADAM17 might increase its binding to USF, thereby promoting ADAM17 gene transcription. Consequently, we evaluated the roles of the five genetic variations in the ADAM17 promoter region in sepsis susceptibility in this study. Our results suggested that rs12692386 A>G might be a potentially functional polymorphism that up-regulated the ADAM17 expression level via affecting gene transcription of ADAM17, which might contribute to the development of sepsis into the severe sepsis/septic shock; in fact, the GA/GG genotypes of rs12692386 were found to be overrepresented among the patients with severe sepsis/septic shock subtypes compare to those with sepsis subtype, further validating the notion that the rs12692386 A>G is a statistically-significant prognostic factor and may serve as a genetic marker for predicting the progression of sepsis in sepsis patients. However, differential levels of ADAM17 were not detected between the different genotypes of rs12692386 in the healthy controls. We speculate that this result could be attributed to low ADAM17 expression level in healthy controls without any pro-inflammatory conditions that the genetic effect of rs12692386 A>G may not be relatively strong to significantly influence the ADAM17 expression level, indicating that ADAM17 may influence the progression of sepsis rather than the occurrence of sepsis. Our further study will explore the molecular mechanisms underlying this functional polymorphism by using a promoter prediction technique and the experimental verification of our results in a cellular sepsis model.

ADAM17, also known as TACE, is initially recognized to convert transmembrane TNF-α to its soluble form, which is recognized as a significant immune regulatory factor contributing to sepsis pathogenesis [41,42,43]. In addition to TNF-α, a wide variety of over 75 substrates are shed by ADAM17, including IL-6R, CX3CL1, L-selectin and ICAM-1 [11,12,13,44]. CX3CL1 can also be generated by ADAM17-dependent cleavage and ectodomain shedding under pro-inflammatory conditions that mediates leukocyte transmigration out of the bloodstream to the inflammation site [45,46]. IL-6R, one of the key substrates of ADAM17, is mainly generated by ADAM17-mediated ectodomain shedding, leading to generation of an agonist of IL-6-mediated inflammatory signaling [47,48,49]. Therefore, we assessed the three representative ADAM17 substrates (TNF-α, IL-6R and CX3CL1) in this study to investigate the relevance of the ADAM17 genetic variations within the promoter region to the serum concentrations of the ADAM17 substrates. Our results showed that the serum concentrations of TNF-α, CX3CL1 and IL-6R were significantly increased in the sepsis cases than in the controls, and that it increased with the aggravation of sepsis, as predicted. Furthermore, the ADAM17 rs12692386 GA/GG genotype carriers exhibited significant increases in the serum concentrations of TNF-α, CX3CL1 and IL-6R compared with the carriers of rs12692386 AA genotype among the sepsis cases. These results were consistent with those of our previous study demonstrating associations between the rs12692386 polymorphism and the expression level of ADAM17, further supporting the notion that the ADAM17 rs12692386 A>G contributed to aggravating the progression of sepsis by increasing the expression of ADAM17, as well as that of its substrates.

Increasing evidence shows that ADAM17 contributes to the cascade release of inflammatory cytokines, such as IL-1β and IL-6, from PBMCs via several inflammation-related signaling pathways [50,51,52]. In addition, ADAM17-deficient mice exhibits a decreased serum concentrations of pro-inflammation cytokines including IL-1β, IL-10 and IL-6, and is protected from sepsis [19,20,53]. Furthermore, the inhibition or the specific antagonist of ADAM17 results in decreased release of IL-6 and IL-1β in macrophages and confers a survival benefit to mice following sepsis [21,22,54]. In this study, we further assessed whether these ADAM17 promoter polymorphisms ultimately influenced serum concentrations of the pro-inflammatory cytokines. Significantly higher serum concentrations of IL-1β and IL-6 were observed in the sepsis cases compare to the controls, as predicted. Importantly, our results suggested that the serum concentrations of IL-1β and IL-6 were significantly higher in the rs12692386 GA/GG genotype carriers than in the AA genotype carriers among the sepsis patients. We speculated that the rs12692386A>G regulated the serum concentrations of IL-1β and IL-6 via affecting gene transcription of ADAM17, thereby causing alterations in the serum concentrations of its substrates and the pro-inflammatory cytokines in the respective genotype carriers, ultimately contributing to the predisposition and pathogenesis of severe sepsis. Further studies are required to confirm these results and investigate the specific underlying mechanisms.

There are some limitations to the present study. Firstly, the small number size of samples in this study may not generate sufficient statistical power to examine a small genetic effect, decreasing the accuracy of the estimations. Secondly, all of the participants of our study are from the Han Chinese ethnic group. Further studies with a greater number of samples from different racial groups is required to draw firm conclusions regarding the definitive roles of the genetic polymorphisms described in the present study in the progression of sepsis.

The ADAM17 genetic variations within the promoter region of ADAM17 may not be major risk factors of sepsis susceptibility in the Chinese Han population. However, the GA/GG genotypes of ADAM17 rs12692386 polymorphism were found to be overrepresented among the patients with severe sepsis/septic shock subtypes compare to those with sepsis subtype, suggesting a susceptible role of rs12692386 A>G in the development of sepsis into the severe sepsis/septic shock subtypes. Moreover, the GA/GG genotypes may increase the expression levels of ADAM17 and its substrates, thereby up-regulating the serum concentrations of pro-inflammation cytokines, which may ultimately result in the progression of sepsis. These results could facilitate the identification of more effective therapeutic targets for patients with sepsis.

This work was supported by funding from the National Nature Science Foundation of China (81471326, 81301038 and 81401061), Technological Special Project of Guangdong Province (2013B021800075) and the Doctoral Starting up Foundation of the Affiliated Hospital of Guangdong Medical University, China (BJ201507).

The authors declare that there is no conflict of interest regarding the publication of this paper.

1.
Lewis DH, Chan DL, Pinheiro D, Armitage-Chan E, Garden OA: The immunopathology of sepsis: Pathogen recognition, systemic inflammation, the compensatory anti-inflammatory response, and regulatory t cells. J Vet Intern Med 2012;26:457-482.
2.
Zeng L, Du J, Gu W, Zhang AQ, Wang HY, Wen DL, Qiu L, Yang XT, Sun JH, Zhang M, Hao J, Jiang JX: Rs1800625 in the receptor for advanced glycation end products gene predisposes to sepsis and multiple organ dysfunction syndrome in patients with major trauma. Crit Care 2015;19:6.
3.
Zhang J, Yang J, Xu X, Liang L, Sun H, Liu G, Zhang L, Su Y: The influence of genetic polymorphisms in tlr4 and tirap, and their expression levels in peripheral blood, on susceptibility to sepsis. Exp Ther Med 2016;11:131-139.
4.
Beppler J, Koehler-Santos P, Pasqualim G, Matte U, Alho CS, Dias FS, Kowalski TW, Velasco IT, Monteiro RC, Pinheiro da Silva F: Fc gamma receptor iia (cd32a) r131 polymorphism as a marker of genetic susceptibility to sepsis. Inflammation 2016;39:518-525.
5.
Georgitsi MD, Vitoros V, Panou C, Tsangaris I, Aimoniotou E, Gatselis NK, Chasou E, Kouliatsis G, Leventogiannis K, Velissaris D, Belesiotou E, Dioritou-Aggaliadou O, Giannitsioti E, Netea MG, Giamarellos-Bourboulis EJ, Giannikopoulos G, Alexiou Z, Voloudakis N, Koutsoukou A, Hellenic Sepsis Study G: Individualized significance of the -251 a/t single nucleotide polymorphism of interleukin-8 in severe infections. Eur J Clin Microbiol Infect Dis 2016;35:563-570.
6.
Lee K, Chang Y, Song K, Park YY, Huh JW, Hong SB, Lim CM, Koh Y: Associations between single nucleotide polymorphisms of high mobility group box 1 protein and clinical outcomes in korean sepsis patients. Yonsei Med 2016;57:111-117.
7.
Cai M, Wang Z, Zhang J, Zhou H, Jin L, Bai R, Weng Y: Adam17, a target of mir-326, promotes emt-induced cells invasion in lung adenocarcinoma. Cell Physiol Biochem 2015;36:1175-1185.
8.
Chen B, Huang Z, Zhang Y, Chen Y, Li Z: Microrna-145 suppresses osteosarcoma metastasis via targeting mmp16. Cell Physiol Biochem 2015;37:2183-2193.
9.
Dreymueller D, Uhlig S, Ludwig A: Adam-family metalloproteinases in lung inflammation: Potential therapeutic targets. Am J Physiol Lung Cell Mol Physiol 2015;308:L325-343.
10.
Edwards DR, Handsley MM, Pennington CJ: The adam metalloproteinases. Mol Aspects Med 2008;29:258-289.
11.
Menghini R, Fiorentino L, Casagrande V, Lauro R, Federici M: The role of adam17 in metabolic inflammation. Atherosclerosis 2013;228:12-17.
12.
Scheller J, Chalaris A, Garbers C, Rose-John S: Adam17: A molecular switch to control inflammation and tissue regeneration. Trends Immunol 2011;32:380-387.
13.
Lisi S, D'Amore M, Sisto M: Adam17 at the interface between inflammation and autoimmunity. Immunol Lett 2014;162:159-169.
14.
Chang MC, Chan CP, Chen YJ, Hsien HC, Chang YC, Yeung SY, Jeng PY, Cheng RH, Hahn LJ, Jeng JH: Areca nut components stimulate adam17, il-1alpha, pge2 and 8-isoprostane production in oral keratinocyte: Role of reactive oxygen species, egf and jak signaling. Oncotarget 2016;7:16879-16894.
15.
Blaydon DC, Biancheri P, Di WL, Plagnol V, Cabral RM, Brooke MA, van Heel DA, Ruschendorf F, Toynbee M, Walne A, O'Toole EA, Martin JE, Lindley K, Vulliamy T, Abrams DJ, MacDonald TT, Harper JI, Kelsell DP: Inflammatory skin and bowel disease linked to adam17 deletion. N Engl J Med 2011;365:1502-1508.
16.
Chalaris A, Adam N, Sina C, Rosenstiel P, Lehmann-Koch J, Schirmacher P, Hartmann D, Cichy J, Gavrilova O, Schreiber S, Jostock T, Matthews V, Hasler R, Becker C, Neurath MF, Reiss K, Saftig P, Scheller J, Rose-John S: Critical role of the disintegrin metalloprotease adam17 for intestinal inflammation and regeneration in mice. J Exp Med 2010;207:1617-1624.
17.
Kermarrec N, Selloum S, Plantefeve G, Chosidow D, Paoletti X, Lopez A, Mantz J, Desmonts JM, Gougerot-Pocidalo MA, Chollet-Martin S: Regulation of peritoneal and systemic neutrophil-derived tumor necrosis factor-alpha release in patients with severe peritonitis: Role of tumor necrosis factor-alpha converting enzyme cleavage. Crit Care Med 2005;33:1359-1364.
18.
Horiuchi K, Kimura T, Miyamoto T, Takaishi H, Okada Y, Toyama Y, Blobel CP: Cutting edge: Tnf-alpha-converting enzyme (tace/adam17) inactivation in mouse myeloid cells prevents lethality from endotoxin shock. J Immunol 2007;179:2686-2689.
19.
Long C, Wang Y, Herrera AH, Horiuchi K, Walcheck B: In vivo role of leukocyte adam17 in the inflammatory and host responses during e. Coli-mediated peritonitis. J Leukoc Biol 2010;87:1097-1101.
20.
Long C, Hosseinkhani MR, Wang Y, Sriramarao P, Walcheck B: Adam17 activation in circulating neutrophils following bacterial challenge impairs their recruitment. J Leukoc Biol 2012;92:667-672.
21.
Tsuji F, Oki K, Okahara A, Suhara H, Yamanouchi T, Sasano M, Mita S, Horiuchi M: Differential effects between marimastat, a tnf-alpha converting enzyme inhibitor, and anti-tnf-alpha antibody on murine models for sepsis and arthritis. Cytokine 2002;17:294-300.
22.
Li X, Yan Y, Huang W, Yang Y: The study of the inhibition of the recombinant tace prodomain to endotoxemia in mice. Int J Mol Sci 2009;10:5442-5454.
23.
Qu D, Wang Y, Esmon NL, Esmon CT: Regulated endothelial protein c receptor shedding is mediated by tumor necrosis factor-alpha converting enzyme/adam17. J Thromb Haemost 2007;5:395-402.
24.
Song D, Ye X, Xu H, Liu SF: Activation of endothelial intrinsic nf-{kappa}b pathway impairs protein c anticoagulation mechanism and promotes coagulation in endotoxemic mice. Blood 2009;114:2521-2529.
25.
Peng Q, Deng Y, Yang X, Leng X, Yang Y, Liu H: Genetic variants of adam17 are implicated in the pathological process of kawasaki disease and secondary coronary artery lesions via the tgf-beta/smad3 signaling pathway. Eur J Pediatr 2016;175:705-713.
26.
Junyent M, Parnell LD, Lai CQ, Arnett DK, Tsai MY, Kabagambe EK, Straka RJ, Province M, An P, Smith CE, Lee YC, Borecki I, Ordovas JM: Adam17_i33708a>g polymorphism interacts with dietary n-6 polyunsaturated fatty acids to modulate obesity risk in the genetics of lipid lowering drugs and diet network study. Nutr Metab Cardiovasc Dis 2010;20:698-705.
27.
Wang M, Li Y, Lu Y, Zuo X, Wang F, Zhang Z, Jia J: The relationship between adam17 promoter polymorphisms and sporadic alzheimer's disease in a northern chinese han population. J Clin Neurosci 2010;17:1276-1279.
28.
Li Y, Cui LL, Li QQ, Ma GD, Cai YJ, Chen YY, Gu XF, Zhao B, Li KS: Association between adam17 promoter polymorphisms and ischemic stroke in a chinese population. J Atheroscler Thromb 2014;21:878-893.
29.
Morange PE, Tregouet DA, Godefroy T, Saut N, Bickel C, Rupprecht HJ, Lackner K, Barbaux S, Poirier O, Peiretti F, Nalbone G, Juhan-Vague I, Blankenberg S, Tiret L: Polymorphisms of the tumor necrosis factor-alpha (tnf) and the tnf-alpha converting enzyme (tace/adam17) genes in relation to cardiovascular mortality: The atherogene study. J Mol Med (Berl) 2008;86:1153-1161.
30.
Holdt LM, Thiery J, Breslow JL, Teupser D: Increased adam17 mrna expression and activity is associated with atherosclerosis resistance in ldl-receptor deficient mice. Arterioscler Thromb Vasc Biol 2008;28:1097-1103.
31.
Li Y, Yang C, Ma G, Cui L, Gu X, Chen Y, Zhao B, Wang H, Li K: Analysis of adam17 polymorphisms and susceptibility to sporadic abdominal aortic aneurysm. Cell Physiol Biochem 2014;33:1426-1438.
32.
Zeng L, Zhang AQ, Gu W, Zhou J, Zhang LY, Du DY, Zhang M, Wang HY, Yan J, Yang C, Jiang JX: Identification of haplotype tag single nucleotide polymorphisms within the receptor for advanced glycation end products gene and their clinical relevance in patients with major trauma. Crit Care 2012;16:R131.
33.
Baghel K, Srivastava RN, Chandra A, Goel SK, Agrawal J, Kazmi HR, Raj S: Tnf-alpha, il-6, and il-8 cytokines and their association with tnf-alpha-308 g/a polymorphism and postoperative sepsis. J Gastrointest Surg 2014;18:1486-1494.
34.
Fakhri D, Djauzi S, Murni TW, Rachmat J, Harahap AR, Rahayuningsih SE, Mansyur M, Santoso A: Genetic polymorphism in postoperative sepsis after open heart surgery in infants. Asian Cardiovasc Thorac Ann 2016;24:326-331.
35.
Cui L, Gao Y, Xie Y, Wang Y, Cai Y, Shao X, Ma X, Li Y, Ma G, Liu G, Cheng W, Liu Y, Liu T, Pan Q, Tao H, Liu Z, Zhao B, Shao Y, Li K: An adam10 promoter polymorphism is a functional variant in severe sepsis patients and confers susceptibility to the development of sepsis. Crit Care 2015;19:73.
36.
Dellinger RP, Levy MM, Rhodes A, Annane D, Gerlach H, Opal SM, Sevransky JE, Sprung CL, Douglas IS, Jaeschke R, Osborn TM, Nunnally ME, Townsend SR, Reinhart K, Kleinpell RM, Angus DC, Deutschman CS, Machado FR, Rubenfeld GD, Webb S, Beale RJ, Vincent JL, Moreno R, Surviving Sepsis Campaign Guidelines Committee including The Pediatric S: Surviving sepsis campaign: International guidelines for management of severe sepsis and septic shock, 2012. Intensive Care Med 2013;39:165-228.
37.
Singer M, Deutschman CS, Seymour CW, Shankar-Hari M, Annane D, Bauer M, Bellomo R, Bernard GR, Chiche JD, Coopersmith CM, Hotchkiss RS, Levy MM, Marshall JC, Martin GS, Opal SM, Rubenfeld GD, van der Poll T, Vincent JL, Angus DC: The third international consensus definitions for sepsis and septic shock (sepsis-3). JAMA 2016;315:801-810.
38.
Knaus WA, Draper EA, Wagner DP, Zimmerman JE: Apache ii: A severity of disease classification system. Crit Care Med 1985;13:818-829.
39.
Stride A, Ellard S, Clark P, Shakespeare L, Salzmann M, Shepherd M, Hattersley AT: Beta-cell dysfunction, insulin sensitivity, and glycosuria precede diabetes in hepatocyte nuclear factor-1alpha mutation carriers. Diabetes Care 2005;28:1751-1756.
40.
Dollery CM, Libby P: Atherosclerosis and proteinase activation. Cardiovasc Res 2006;69:625-635.
41.
Schwarz J, Schmidt S, Will O, Koudelka T, Kohler K, Boss M, Rabe B, Tholey A, Scheller J, Schmidt-Arras D, Schwake M, Rose-John S, Chalaris A: Polo-like kinase 2, a novel adam17 signaling component, regulates tumor necrosis factor alpha ectodomain shedding. J Biol Chem 2014;289:3080-3093.
42.
DeBerge MP, Ely KH, Cheng GS, Enelow RI: Adam17-mediated processing of tnf-alpha expressed by antiviral effector cd8+ t cells is required for severe t-cell-mediated lung injury. PloS one 2013;8:e79340.
43.
Kruger P, Bailey M, Bellomo R, Cooper DJ, Harward M, Higgins A, Howe B, Jones D, Joyce C, Kostner K, McNeil J, Nichol A, Roberts MS, Syres G, Venkatesh B, Group AN-SI-ACT: A multicenter randomized trial of atorvastatin therapy in intensive care patients with severe sepsis. Am J Respir Crit Care Med 2013;187:743-750.
44.
Dusterhoft S, Michalek M, Kordowski F, Oldefest M, Sommer A, Roseler J, Reiss K, Grotzinger J, Lorenzen I: Extracellular juxtamembrane segment of adam17 interacts with membranes and is essential for its shedding activity. Biochemistry 2015;54:5791-5801.
45.
Schwarz N, Pruessmeyer J, Hess FM, Dreymueller D, Pantaler E, Koelsch A, Windoffer R, Voss M, Sarabi A, Weber C, Sechi AS, Uhlig S, Ludwig A: Requirements for leukocyte transmigration via the transmembrane chemokine cx3cl1. Cell Mol Life Sci 2010;67:4233-4248.
46.
Garton KJ, Gough PJ, Blobel CP, Murphy G, Greaves DR, Dempsey PJ, Raines EW: Tumor necrosis factor-alpha-converting enzyme (adam17) mediates the cleavage and shedding of fractalkine (cx3cl1). J Biol Chem 2001;276:37993-38001.
47.
Garbers C, Janner N, Chalaris A, Moss ML, Floss DM, Meyer D, Koch-Nolte F, Rose-John S, Scheller J: Species specificity of adam10 and adam17 proteins in interleukin-6 (il-6) trans-signaling and novel role of adam10 in inducible il-6 receptor shedding. J Biol Chem 2011;286:14804-14811.
48.
Dusterhoft S, Hobel K, Oldefest M, Lokau J, Waetzig GH, Chalaris A, Garbers C, Scheller J, Rose-John S, Lorenzen I, Grotzinger J: A disintegrin and metalloprotease 17 dynamic interaction sequence, the sweet tooth for the human interleukin 6 receptor. J Biol Chem 2014;289:16336-16348.
49.
Scheller J, Chalaris A, Schmidt-Arras D, Rose-John S: The pro- and anti-inflammatory properties of the cytokine interleukin-6. Biochim Biophys Acta 2011;1813:878-888.
50.
Uchikawa S, Yoda M, Tohmonda T, Kanaji A, Matsumoto M, Toyama Y, Horiuchi K: Adam17 regulates il-1 signaling by selectively releasing il-1 receptor type 2 from the cell surface. Cytokine 2015;71:238-245..
51.
Lisi S, Sisto M, Lofrumento DD, D'Amore M: Sjogren's syndrome autoantibodies provoke changes in gene expression profiles of inflammatory cytokines triggering a pathway involving tace/nf-kappab. Lab Invest 2012;92:615-624.
52.
Yan I, Schwarz J, Lucke K, Schumacher N, Schumacher V, Schmidt S, Rabe B, Saftig P, Donners M, Rose-John S, Mittrucker HW, Chalaris A: Adam17 controls il-6 signaling by cleavage of the murine il-6ralpha from the cell surface of leukocytes during inflammatory responses. J Leukoc Biol 2016;99:749-760.
53.
Tsukerman P, Eisenstein EM, Chavkin M, Schmiedel D, Wong E, Werner M, Yaacov B, Averbuch D, Molho-Pessach V, Stepensky P, Kaynan N, Bar-On Y, Seidel E, Yamin R, Sagi I, Elpeleg O, Mandelboim O: Cytokine secretion and nk cell activity in human adam17 deficiency. Oncotarget 2015;6:44151-44160.
54.
Zhang Y, Hegen M, Xu J, Keith JC, Jr., Jin G, Du X, Cummons T, Sheppard BJ, Sun L, Zhu Y, Rao VR, Wang Q, Xu W, Cowling R, Nickerson-Nutter CL, Gibbons J, Skotnicki J, Lin LL, Levin J: Characterization of (2r, 3s)-2-([[4-(2-butynyloxy)phenyl]sulfonyl]amino) -n,3-dihydroxybutana -mide, a potent and selective inhibitor of tnf-alpha converting enzyme. Int Immunopharmacol 2004;4:1845-1857

Y. Shao, J. He and F. Chen contributed equally to this work.

Open Access License / Drug Dosage / Disclaimer
This article is licensed under the Creative Commons Attribution-NonCommercial-NoDerivatives 4.0 International License (CC BY-NC-ND). Usage and distribution for commercial purposes as well as any distribution of modified material requires written permission. Drug Dosage: The authors and the publisher have exerted every effort to ensure that drug selection and dosage set forth in this text are in accord with current recommendations and practice at the time of publication. However, in view of ongoing research, changes in government regulations, and the constant flow of information relating to drug therapy and drug reactions, the reader is urged to check the package insert for each drug for any changes in indications and dosage and for added warnings and precautions. This is particularly important when the recommended agent is a new and/or infrequently employed drug. Disclaimer: The statements, opinions and data contained in this publication are solely those of the individual authors and contributors and not of the publishers and the editor(s). The appearance of advertisements or/and product references in the publication is not a warranty, endorsement, or approval of the products or services advertised or of their effectiveness, quality or safety. The publisher and the editor(s) disclaim responsibility for any injury to persons or property resulting from any ideas, methods, instructions or products referred to in the content or advertisements.