SGK1-Sensitive Regulation of Cyclin-Dependent Kinase Inhibitor 1B (p27) in Cardiomyocyte Hypertrophy Open Access

Cardiac remodeling is a pathophysiological response to a variety of challenges including pressure overload [1] and excessive adrenergic stimulation with isoproterenol [2]. Signaling contributing to cardiac remodeling includes the serum- and glucocorticoid-inducible kinase SGK1 [3,4,5,6], a kinase genomically up-regulated by a variety of hormones including glucocorticoids [7], mineralocorticoids [8] and TGFβ [9]. Stimulators of SGK1 activity include phosphoinositide 3-kinase (PI3K)/phosphoinositide-dependent kinase PDK1 [10] and mammalian target of rapamycin protein complex mTORC2 [11,12,13]. SGK1 presumably contributes to the known stimulation of cardiac hypertrophy by PI3K and participates in tissue fibrosis [6,9,14,15,16,17].

Lack of SGK1 counteracts cardiac remodeling during pressure overload [4,5], mineralocorticoid excess [6], glucocorticoid excess [18] and angiotensin-II infusion [19]. SGK1-dependent mechanisms contributing to cardiac remodeling include stimulation of Na⁺/H⁺ exchanger Nhe1 [5,20] with Nhe1-sensitive [21] expression of osteopontin [5,22], inflammatory response modulation [19,23] and late-sodium current activation [4].

SGK1 phosphorylation targets include cyclin-dependent kinase inhibitor 1B (p27) [13], a powerful blocker of cell proliferation [24,25]. SGK1 and PKB act downstream of PI3K and phosphorylate p27^T157 and p27^T198 leading to impaired nuclear import of p27 and its accumulation in the cytoplasm [13,26,27].

P27 is strongly expressed in the heart [24] and down-regulated during and suppressing cardiac remodelling following heart failure [28], pressure overload [29], cardiac hypertrophy [24,25,30] and myocardial infarction [31]. P27 expression is up-regulated by genetic knockout of the Nhe1 [32], which participates in the SGK1-sensitive cardiac remodelling following pressure overload [5]. Genetic knockout of p27 leads to increased heart size and total number of cardiac myocytes [33]. The present study addressed the involvement of p27 in the stimulation of cardiac hypertrophy by SGK1.

The constitutively active SGK1^S422D and inactive SGK1^K127N constructs in pcDNA3.1 were described previously [34]. The construct encoding mouse p27 in pCMV-SPORT6 was purchased from Source BioScience LifeSciences. The p27^T197A and p27^T197D mutants were generated by site-directed mutagenesis using QuikChange II XL Site-Directed Mutagenesis Kit (Stratagene) according to the manufacturer's instructions. The following primers were used (5'→3' orientation):

p27^T197A sense: CGGAGCTGTTTACGCCTGGCGTCGAAGGC;

p27^T197A antisense: GCCTTCGACGCCAGGCGTAAACAGCTCCG;

p27^T197D sense: TTAATTCGGAGCTGTTTAGTCCTGGCGTCGAAGGCCGGG;

p27^T197D antisense: CCCGGCCTTCGACGCCAGGACTAAACAGCTCCGAATTAA.

Underlined bases indicate mutation sites. The mutants were sequenced to verify the presence of the desired mutations.

HL-1 cardiomyocytes (kindly provided by Dr. W.C. Claycomb) were maintained in Claycomb medium supplemented with 10% FBS, 0.1mM norepinephrine, 2mM L-Glutamine (Sigma Aldrich), 100 units/ml penicillin and 100µg/ml streptomycin (Invitrogen). The medium was changed approximately every 24 hours. HL-1 cardiomyocytes were transfected with 2 µg DNA encoding constitutively active SGK1^S422D, inactive SGK1^K127N, wild-type p27^WT, p27^T197A mutant, p27^T197D mutant or with empty vectors as control using X-tremeGENE HP DNA transfection reagent (Roche) according to the manufacturer's protocol. The cells were used 48 hours after transfection. Transfection efficiency was verified by quantitative RT-PCR. HL-1 cardiomyocytes were treated for 24 hours with 50 µM EMD638683 [35] and/or 1 µM isoproterenol [36]. Equal amounts of vehicle were used as control.

All animal experiments were conducted according to the German law for the welfare of animals and were approved by local authorities. The origin of the mice has been described previously [37]. Cardiac pressure overload [38] was induced in 8-11-week-old mice as described [5,36]. After anesthesia, intubation and ventilation (Harvard apparatus) of the mouse, the transverse aorta was surgically exposed and constricted by the width of a 27-G cannula using a 7-0 suture. Animals were treated with buprenorphine after the procedure. Animals were sacrificed 10 days after the procedure and left ventricular tissues snap frozen in liquid nitrogen.

Total RNA was isolated from murine heart and HL-1 cardiomyocytes using Trifast Reagent (Peqlab) according to the manufacturer's instructions [39]. Reverse transcription of 2µg RNA was performed using oligo(dT)_12-18 primers (Invitrogen) and SuperScript III Reverse Transcriptase (Invitrogen). Quantitative RT-PCR was performed with the iCycleriQ™ Real-Time PCR Detection System (Bio-Rad Laboratories) and iQSybr Green Supermix (Bio-Rad Laboratories) according to the manufacturer's instructions [40]. The following primers were used (5'→3' orientation):

Acta1 fw: CCCAAAGCTAACCGGGAGAAG;

Acta1 rev: GACAGCACCGCCTGGATAG;

p27 fw: TCTCTTCGGCCCGGTCAAT;

p27 rev: AAATTCCACTTGCGCTGACTC;

Gapdh fw: AGGTCGGTGTGAACGGATTTG;

Gapdh rev: TGTAGACCATGTAGTTGAGGTCA;

SGK1 fw: CTGCTCGAAGCACCCTTACC;

SGK1 rev: TCCTGAGGATGGGACATTTTCA.

The specificity of the PCR products was confirmed by analysis of the melting curves. All PCRs were performed in duplicate and relative mRNA fold changes were calculated by the 2^-ΔΔCt method using Gapdh as internal reference.

HL-1 cardiomyocytes were fixed with 4% paraformaldehyde/PBS for 15 min at RT and permeabilized with PBS/0.1% Triton-X for 10 min at RT. After blocking with 5% normal goat serum in PBS/0.1% Triton-X for 1 hour at RT, the slides were incubated overnight at 4°C with rabbit anti-p27 antibody (diluted 1:50, Abcam) or with rabbit anti-SGK1 antibody (diluted 1:50, Pineda) and then with goat anti-rabbit Alexa Fluor488-conjugated antibody (diluted 1:1,000, Invitrogen) for 1 hour at RT. Nuclei were stained using DRAQ-5 dye (diluted 1:1000, Biostatus) and actin using Rhodamine Phalloidin (diluted 1:100, Invitrogen). The slides were mounted with Prolong Gold antifade reagent (Invitrogen). Images were collected with a confocal laser-scanning microscope (LSM 510, Carl Zeiss MicroImaging GmbH) using a water immersion A-Plan ×63/1.2W. Negative controls were carried out simultaneously by omitting incubation with primary antibodies. Cell size was quantified by measuring the area of attached cells in Rhodamine Phalloidin stained HL-1 cardiomyocytes with Zen Lite software (Zeiss). 30 random cells were analyzed in 5-6 pictures of each biological replicate [41].

The preparation of cytoplasmic and nuclear extracts from murine heart was performed using the NEPER nuclear and cytoplasmic extraction reagents (Thermo Fisher Scientific) according to the manufacturer's instructions. Protein concentration was determined by Bradford assay (Biorad Laboratories).

Proteins were isolated from murine heart and from HL-1 cardiomyocytes using IP lysis buffer (Thermo Fisher Sciencific) supplemented with complete protease and phosphatase inhibitor cocktail (Thermo Fisher Sciencific). Protein concentration was determined by Bradford assay (Biorad Laboratories). Equal amounts of proteins were boiled in Roti-Load1 Buffer (Carl Roth) at 100°C for 10 min, separated on SDS-polyacrylamide gels and transferred to PVDF membranes [42]. The membranes were incubated overnight at 4°C with rabbit anti-p27 antibody (diluted 1:1000, Abcam), rabbit anti-Hdac2 antibody (diluted 1:1000, Cell Signaling), rabbit anti-α-tubulin antibody (diluted 1:1000, Cell Signaling) or rabbit anti-Gapdh antibody (diluted 1:1000, Cell Signaling) and then with secondary goat anti-rabbit HRP-conjugated antibody (diluted 1:1000, Cell Signaling) for 1 hour at RT. For loading controls, the membranes were stripped in stripping buffer (Thermo Fisher Scientific) for 10 min at RT. Antibody binding was detected with the ECL detection reagent (Thermo Fisher Scientific) and bands were quantified using Quantity One Software (Bio-Rad Laboratories). Results are shown as the normalized ratio of nuclear to cytoplasmic p27 normalized to Hdac2 or α-tubulin for the nuclear or the cytoplasmic fraction, respectively or the ratio of total protein to Gapdh normalized to the vector transfected HL-1 cardiomyocytes or sham treated sgk1+/+ mice, respectively.

Data are shown as arithmetic mean ± SEM. Normality was tested with Shapiro-Wilk test. Non-normal data were log-transformed prior to statistical testing to provide normality. Statistical testing was performed by one-way Anova followed by Tukey-test for homoscedastic data or Games-Howell test for heteroscedastic data. Non-normal data was tested by the Steel-Dwass method. Two groups were compared using unpaired two-tailed t-test. p<0.05 was considered statistically significant.

In a first series of experiments, HL-1 cardiomyocytes were transfected with empty vector as control, with constitutively active SGK1 (SGK1^S422D) or with inactive SGK1 (SGK1^K127N) (Fig. 1D) and the hypertrophic response was determined. As illustrated in Fig. 1, overexpression of constitutively active SGK1^S422D but not of inactive SGK1^K127N significantly increased the cell size (Fig. 1A, B) and significantly up-regulated Acta1 mRNA expression, a molecular marker of hypertrophy (Fig. 1C) in HL-1 cardiomyocytes. Further experiments addressed the effects of SGK1 overexpression on p27 protein abundance and localization. Overexpression of constitutively active SGK1^S422D but not of inactive SGK1^K127N decreased the nuclear abundance of p27 in HL-1 cardiomyocytes (Fig. 2A). However, overexpression of neither, constitutively active SGK1^S422D nor inactive SGK1^K127N significantly modified p27 total protein abundance in HL-1 cardiomyocytes (Fig. 2B), indicating that SGK1 primarily regulates p27 subcellular localization.

To gain further insight into SGK1-sensitive regulation of p27, an additional series of experiments was performed in HL-1 cardiomyocytes treated with isoproterenol in the absence or presence of the SGK1 inhibitor EMD638683. As shown by immunostaining with subsequent confocal microscopy, isoproterenol treatment of HL-1 cardiomyocytes was followed by an up-regulation of SGK1 protein abundance, which mainly localized to the cytoplasm (Fig. 3A). Isoproterenol increased SGK1 mRNA expression, an effect not significantly modified by the SGK1 inhibitor EMD638683 in HL-1 cardiomyocytes (Fig. 3B). Furthermore, isoproterenol induced the virtually complete disappearance of p27 from the nuclei of HL-1 cardiomyocytes, an effect prevented by EMD638683 (Fig. 4A). EMD638683 abolished the isoproterenol-induced increase of cell size (Fig. 4B, C) and up-regulation of Acta1 mRNA expression (Fig. 4D).

Phosphorylation of human p27^T198, a SGK1 phosphorylation site corresponding to murine p27^T197, is known to interfere with the nuclear import of p27 [13]. The effects of p27^T197 phosphorylation on SGK1-induced hypertrophic response were assayed by overexpression of wild-type p27 (p27^WT), of p27^T197A mutant lacking the T197 phosphorylation site or of phosphomimetic p27^T197D mutant with overexpression of constitutively active SGK1^S422D in HL-1 cardiomyocytes (Fig. 5C, D). As shown in Fig. 5A by confocal microscopy, transfection with constitutively active SGK1^S422D was followed by disappearance of p27 from the nuclei, an effect slightly ameliorated by overexpression of p27^WT, which was found in the nucleus and increased in the cytoplasm. The p27^T197A mutant localized predominantly to the nuclei, while the p27^T197D localized exclusively to the cytoplasm, thereby confirming the role of SGK1 on T197-meditated regulation of p27 cellular localization. Furthermore, the Acta1 mRNA expression was significantly up-regulated in constitutively active SGK1^S422D transfected HL-1 cardiomyocytes. The SGK1^S422D-induced increase of Acta1 mRNA levels was significantly lower following overexpression of p27^WT, even more suppressed following overexpression of p27^T197A, but unchanged following overexpression of the phosphomimetic p27^T197D mutant (Fig. 5B). Taken together, phosphorylation of p27 at T197 down-regulated nuclear localization of p27 and was apparently required for the SGK1-induced hypertrophic response in cardiomyocytes.

Additional experiments were performed in SGK1-deficient (sgk1^-/-) and respective wild-type mice (sgk1^+/+) subjected to pressure overload by transverse aortic constriction (TAC). TAC induced a significant increase of SGK1 mRNA expression in cardiac tissue of sgk1^+/+ mice (Fig. 6A). Moreover, TAC was followed by a significant up-regulation of Acta1 mRNA expression in cardiac tissue of sgk1^+/+ mice as compared to sham treated mice, an effect significantly blunted in the sgk1^-/- mice (Fig. 6B). TAC treatment further significantly decreased nuclear p27 localization in cardiac tissue of sgk1^+/+ mice as compared to sham treated mice, an effect completely lacking in the sgk1^-/- mice (Fig. 6C). Accordingly, the nuclear p27 localization was significantly higher in cardiac tissue of sgk1^-/- mice than of sgk1^+/+ mice following TAC. Again, no significant differences of p27 total protein abundance between the groups was observed (Fig. 6D).

The present study reveals SGK1-sensitive regulation of cyclin-dependent kinase inhibitor 1B (p27) in cardiomyocytes. Similar to earlier observations [3,4,5], SGK1 inhibition ameliorates cardiac hypertrophy as indicated by Acta1 expression. The effects of SGK1 involved p27 phosphorylation. SGK1 phosphorylates p27^T157 (site lacking in the mouse p27 sequence) and p27^T198 (corresponding to the mouse p27^T197 site) thereby decreasing nuclear import of p27 leading to a mislocalization of this protein in the cytoplasm [13]. In both, human and mouse p27, the T198/T197 phosphorylation site represents an optimal consensus sequence specific for SGK1 phosphorylation site recognition motif (RRXS/T, where X is any amino acid, and S/T is the phosphorylated residue) [43]. In SGK1^S422D transfected HL-1 cardiomyocytes the overexpressed p27 was found in the cytoplasm, but also still observed in the nucleus. P27 transfection slightly but significantly decreased Acta1 mRNA expression, an effect possibly due to incomplete phosphorylation of overexpressed p27 or incomplete inhibition of p27 by SGK1-dependent phosphorylation. The SGK1 insensitive p27^T197A mutant was found in the nucleus, while the phosphomimetic p27^T197D mutant localized to the cytoplasm, confirming the regulation of p27 localization by Sgk1-dependent phosphorylation of p27^T197. Acta1 mRNA expression was markedly decreased by overexpression of SGK1 insensitive p27^T197A mutant, but not by the phosphomimetic p27^T197D mutant, indicating that SGK1-induced cardiac hypertrophy requires p27^T197 phosphorylation.

P27 overexpression, which shows nuclear localization, prevents cardiac hypertrophy in rat hearts after myocardial infarction [31]. P27 is down-regulated in the failing human heart [44] and p27 inactivation is required for cardiac hypertrophy [24]. In failing hearts, increased cytoplasmic localization of p27 was observed [45]. Cytoplasmic p27 is subject to proteasomal degradation [46]. However, T198 phosphorylation apparently leads to cytoplasmic localization of p27 without accelerating its degradation [47,48]. No differences in total p27 protein levels were observed in hypertrophic mouse hearts or SGK1 transfected HL-1 cardiomyocytes.

Anti-hypertrophic effects of p27 involve casein kinase II-alpha [24]. The exact downstream effectors of p27 in cardiomyocytes are, however, still elusive [24]. P27 presumably controls a currently unknown factor to prevent cardiac hypertrophy. The heart does not express high levels of the p27 target cyclin E-Cdk2 [24]. Cytoplasmic p27 has distinct signalling effects from nuclear cell cycle inhibition, including activation of STAT3 [49]. Accordingly, SGK1-deficient mice show impaired cardiac STAT3 activation [19]. SGK1 presumably stimulates the Na⁺/H⁺ exchangers Nhe1 [17] and Spp1 expression [22], the voltage-gated sodium channel complex Nav1.5 [4] and Gsk3β [50] by direct phosphorylation [3,4,17]. All are implicated as effectors in cardiac hypertrophy and remodeling [4,17,20,21,51,52]. To which extent these effects are related to cytoplasmic p27 re-localization during cardiac hypertrophy remains to be shown. More than one pathway may be involved in the effects of SGK1 on cardiac hypertrophy.

In conclusion, the current observations show that SGK1 impairs nuclear abundance of p27 and suggest that phosphorylation of p27^T197 by SGK1 is required for cardiac hypertrophy.

SGK1 (serum- and glucocorticoid-inducible kinase 1); Cdkn1b (cyclin-dependent kinase inhibitor 1B); TAC (transverse aortic constriction); Acta1 (actin, alpha skeletal muscle); Nhe1 (Na⁺/H⁺ exchanger); PI3K (phosphoinositide 3-kinase).

This work was supported by grants from the Deutsche Forschungsgemeinschaft andOpen Access Publishing Fund of Tuebingen University.

We do confirm that the funder had played no role in study design, collection, analysis and interpretation of data, writing of the report and in the decision to submit the article for publication.

The authors gratefully acknowledge Prof. Dr. W.C. Claycomb for providing the HL-1 cardiomyocytes, the outstanding technical assistance of E. Faber and preparation of the manuscript by T. Loch.

The authors of this manuscript state that they have no conflicts of interest to declare.