The JAK2V617F point mutation has been implicated in the pathogenesis of the vast majority of myeloproliferative neoplasms (MPNs), but translocations involving JAK2 have increasingly been identified in patients with JAK2V617F-negativeMPNs. Here, we present a case of a patient diagnosed with JAK2V617F-negativepolycythemia vera (PV) that transformed to the MPN-blast phase. Cytogenetic and FISH analysis revealed a novel translocation of t(1;9)(p36;p24.1), causing a PEX14-JAK2 gene fusion product. The t(1;9)(p36;p24.1) represents a new addition to the list of known translocations involving JAK2that have been identified in hematologic malignancies. Although the prognostic and treatment implications of JAK2 translocations in MPNs have not been elucidated, positive outcomes have been described in case reports describing the use of JAK inhibitors in these patients. Further research into the role of JAK2 translocations in the pathogenesis and outcomes of hematologic malignancies is warranted.

The JAK (Janus kinase) proteins are a family of cytoplasmic tyrosine kinases involved in the JAK-STAT signaling pathway and are essential in maintaining normal hematopoiesis. The JAK2gene, located on chromosome 9p24, encodes for a receptor predominantly responsive to type I cytokine ligands, including erythropoietin, thrombopoietin, and granulocyte-macrophage colony-stimulating factor. Ligand binding to JAK2 leads to autophosphorylation and activation of STAT (signal transducers and activators of transcription) proteins, which mediate the expression of genes involved in hematopoiesis [1].

Constitutive activation of the JAK-STAT pathway through the acquired point activating mutation on exon 14 (JAK2V617F) has been implicated in the pathogenesis of myeloproliferative neoplasms (MPNs). This mutation is present in 98% of polycythemia vera (PV), 40–50% of essential thrombocythemia (ET), and 50–60% of primary myelofibrosis (PMF) [2, 3], and is present in 20% of patients with non-classical MPNs [4]. Additionally, a subset of patients with JAK2V617F-negative MPNs is found to have translocations involving JAK2, which result in gene fusion products that lead to JAK2 amplification or constitutive activation of the tyrosine kinase. These translocations are not limited to the MPNs, but have also been identified in de novo leukemias of both myeloid and lymphoid lineages (Table 2).

Here, we describe a case of JAK2V617F-negative PV with a novel JAK2translocation. We also provide a review of the known JAK2 translocations associated with PV and other MPNs.

A 52-year-old woman initially presented in 2008 with symptoms of headaches, dizziness, fatigue, shortness of breath, and paresthesias of the hands and feet with an HCT of 61% and normal WBC and PLT counts. Bone marrow biopsy showed a hypercellular marrow (95%) with increased megakaryocytes in clusters, without reticulin staining. The patient was found to meet the World Health Organization’s (WHO) diagnostic criteria for JAK2V617F mutation-negative PV and was initiated on treatment with aspirin and therapeutic phlebotomy, to maintain the HCT <42%.

A year later, the patient developed leukocytosis (WBC 30 × 109/L) and thrombocytosis (PLT 600,000/L). She was started on hydroxyurea, with subsequent improvement in leukocytosis and thrombocytosis, but developed treatment-emergent anemia. Repeat bone marrow biopsy showed a hypercellular marrow (100%) with trilineage hematopoiesis, marked granulocytic hyperplasia, increased immature forms, markedly increased eosinophils (31%), and 7% blasts. Peripheral blood flow cytometry showed a small CD33+ and CD34+ myeloblast population (1.4%).

Several months later, the patient developed constitutional symptoms. The WBC was found to be elevated to 72 × 109/L and peripheral blasts were 21%, consistent with transformation to MPN-blast phase (MPN-BP), a form of secondary acute myeloid leukemia (AML). Decitabine was initiated and after receiving 4 cycles the patient underwent hematopoietic stem cell transplantation (HSCT) in August 2010 with cells from a 10/10 matched unrelated donor, with successful engraftment. The post-transplant bone marrow biopsy, however, showed persistent hypercellularity (80–90%) and persistent myeloblast populations ranging from 1.1 to 8%, consistent with residual disease. Unfortunately, the patient’s course was complicated by graft-versus-host disease of the gastrointestinal system and central nervous system. Ultimately, the patient succumbed to sepsis on day +106 post-transplant.

Cytogenetic and FISH Analysis

Conventional cytogenetic preparations and FISH (fluorescent in situ hybridization) analyses were performed as described previously [5, 6]. To detect the exact region involved in the novel translocation, 12 FISH probes were used: 9p24.1 (RP11-3H3), 9p24.1 (RP11-28A9; BACPAC Resources, Oakland, CA, USA), 1p36.22 (RP11-483P2), 1p36.22 (RP11-1107P2), RP11-1134M20, RP11-483P2, RP11-1107P2 (Empire Genomics, Buffalo, NY, USA), 9q34 (ABL1), 22q11.2 (BCR), 1p36 (p58), 1p36 (CEP108/T7), 1q25, WCP19, telomere 1p, telomere 19p (Abbott Molecular, Abbott Park, IL, USA). FISH chimerism was detected using XX/XY probes (Abbott Molecular). FISH probes, including bacterial artificial chromosomes (BACs), were fluorescently labeled by the manufacturer excluding RP11-3H3 and RP11-28A9, which were fluorescently labeled using the Nick translation kit (Abbott Molecular) following the manufacturer’s procedure [5]. DNA isolated from bone marrow cells was subjected to whole-genome sequencing and analyzed by standard pipelines at the Sanger Institute, Hinxton, UK [7].

Confirmation of a PEX14-JAK2genomic DNA fusion was performed using a forward primer in PEX14 exon 8 (5′CCACCAACTGGATCCTGGAGT) and reverse primer in JAK2exon 19 (5′AACCCCAGGGCACCTATCCT), on 25 ng of DNA using the Expand Long-Template LT-PCR system 2 (Roche, Burgess Hill, Sussex, UK) at an annealing temperature of 64°C and an elongation time of 4 min. Sequencing across the breakpoint was performed using primer PEX14 exon 9 (5′GTTCCCTCCATCCCCATCAG), using an Applied Biosystems 3130 analyzer (Foster City, CA, USA).

The presence of PEX14-JAK2 fusion mRNA was confirmed on random hexamer reverse-transcribed cDNA, using forward primer PEX14 exon 8 and reverse primer in JAK2 exon 21 (5′ TTTTAGATTACGCCGACCAGCA) using the Expand High Fidelity PCR System, an annealing temperature of 64°C, and an elongation time of 1 min. The product was sequenced in both directions using the same primers.

A summary of the conventional cytogenetic analysis is shown in Table 1. Initial bone marrow cytogenetic analysis, a year after the diagnosis of PV, showed 50% of evaluated metaphase cells to have the t(1;9)(p36;p24.1) karyotype. Subsequent metaphase FISH analyses using BAC FISH probes (RP11-3H3 and RP11-28A9) revealed that the 3′ portion of JAK2 was translocated to 1p36, while the 5′ portion remained on 9p24.1, indicating a JAK2 structural rearrangement (Fig. 1). To investigate the exact breakpoint on chromosome 1, we used a FISH BAC probe, and as shown in Figure 1, the BAC FISH probe RP11-4832P2 normally localized on chromosome 1p36 was detected on 9p24.1 (aqua), whereas BAC RP11-1107P2 remained on 1p36. Therefore, the breakpoint on chromosome 1, involved in the JAK2translocation, was determined to be within band p36.22 on chromosome 1 [7].

Table 1.

Summary of cytogenetic and FISH results

 Summary of cytogenetic and FISH results
 Summary of cytogenetic and FISH results
Fig. 1.

The first row shows a partial karyotype of chromosomes 1 and 9. Metaphase FISH was performed using BAC FISH probes. RP11-3H3 (labeled in aqua) normally localized to the 5′ portion of JAK2 on 9p24.1 was translocated to 1p36, while the telomere of chromosome 1p (labeled in green) translocated to the derivative chromosome 9. The second row shows that the BAC FISH probe RP11-4832P2 (labeled in aqua) normally localized on chromosome 1p36 was detected on 9p24.1, whereas BAC RP11-1107P2 (labeled in red) remained on 1p36. The chromosomal breakpoint on chromosome 1 was determined to be within band 1p36.22.

Fig. 1.

The first row shows a partial karyotype of chromosomes 1 and 9. Metaphase FISH was performed using BAC FISH probes. RP11-3H3 (labeled in aqua) normally localized to the 5′ portion of JAK2 on 9p24.1 was translocated to 1p36, while the telomere of chromosome 1p (labeled in green) translocated to the derivative chromosome 9. The second row shows that the BAC FISH probe RP11-4832P2 (labeled in aqua) normally localized on chromosome 1p36 was detected on 9p24.1, whereas BAC RP11-1107P2 (labeled in red) remained on 1p36. The chromosomal breakpoint on chromosome 1 was determined to be within band 1p36.22.

Close modal

Five months from the initial analysis, 100% of the cells had t(1;9) and 10% had developed a subclone consisting of balanced t(7;17)(q22.1;25.3) and trisomy 1q in the form of unbalanced der(15)t(1;15)(q12;q26). Following HSCT, host cells were never eradicated (Table 1). A year after the initial cytogenetic analysis, the original abnormal host clone and a subclone were present in 100% of the cells with additional chromosomal abnormalities consistent with complex subclonal evolution.

To characterize the t(1;9) in detail, we performed whole-genome sequencing analysis of patient bone marrow DNA to identify the translocation breakpoints. Focusing on the analysis of JAK2, we identified two split reads that mapped to PEX14 exon 9 and JAK2 intron 18. PEX14maps to 1p36.22, and was thus a strong candidate to be fused to JAK2. To confirm a PEX14-JAK2 fusion, we amplified patient and control DNA using primers located in PEX14exon 9 and JAK2 exon 19. A product was obtained from the t(1;9) case only (not shown), which, upon sequencing, confirmed a break within PEX14 exon 9 and JAK2intron 18 (Fig. 2). Amplification from cDNA also yielded a specific product from the t(1;9) case but not the controls (Fig. 3), sequencing of which showed a fusion between a truncated PEX14exon 9 and JAK2exon 19 (Fig. 2). Comparison of the cDNA and genomic sequences indicates that two nucleotides (TA) from JAK2 intron 18 were retained in the mature mRNA that result in maintenance of the correct reading frame (Fig. 2). The TA dinucleotide is immediately followed by GT, which must have acted as a splice donor site.

Fig. 2.

Sequence trace of the PEX14-JAK2 amplicon from genomic DNA (above) plus the alignment of genomic sequences of PEX14, PEX14-JAK2, and JAK2 in the relevant region (below). The two nucleotides from JAK2 intron 18 that are retained in the mature mRNA are indicated in italics and the cryptic splice donor site in bold.

Fig. 2.

Sequence trace of the PEX14-JAK2 amplicon from genomic DNA (above) plus the alignment of genomic sequences of PEX14, PEX14-JAK2, and JAK2 in the relevant region (below). The two nucleotides from JAK2 intron 18 that are retained in the mature mRNA are indicated in italics and the cryptic splice donor site in bold.

Close modal
Fig. 3.

Specific amplification of cDNA from the t(1;9) case using primers to PEX14 exon 9 and JAK2 exon 19. The sequence of the mRNA junction with the PEX14 sequence is in plain type, with JAK2 in bold, and the two intron-derived nucleotides in italics.

Fig. 3.

Specific amplification of cDNA from the t(1;9) case using primers to PEX14 exon 9 and JAK2 exon 19. The sequence of the mRNA junction with the PEX14 sequence is in plain type, with JAK2 in bold, and the two intron-derived nucleotides in italics.

Close modal

Subsequent to the 2005 discovery of JAK2V617F, knowledge of the genetic underpinnings of MPNs and the role mutations play in diagnosis, prognosis and therapy increased exponentially [8‒11]. In stark contrast to the wealth of knowledge about the JAK2V617F-positive MPNs, there is a relative dearth of information on how to approach the small subset of patients with MPNs who lack this point mutation but contain JAK2 translocations.

Translocations at 9p24.1 and resultant gene fusion products have been identified in a wide spectrum of hematologic malignancies of myeloid and lymphoid origin, including acute lymphoblastic leukemia (ALL), chronic myeloid leukemia (CML), chronic eosinophilic lymphoma (CEL), and the BCR-ABL1-negative MPNs (Table 2). Additionally, several translocations involving 9p24.1 with subsequent gene fusion products involving JAK2 have been seen in solid malignancies, such as breast cancer [12] and small cell lung cancer [13].

Table 2.

JAK2 translocations and associated gene fusion products in hematologic malignancies

JAK2 translocations and associated gene fusion products in hematologic malignancies
JAK2 translocations and associated gene fusion products in hematologic malignancies

JAK2translocations are likely more common in hematologic malignancies than previously recognized. Patnaik et al. [3] screened over 24,000 patient cytogenetic reports and found 5 patients harboring translocations at 9p24 with gene fusion products involving JAK2. All 5 of the translocations described in this subset of patients had not previously been reported in the literature, but the JAK2 fusion partners could not be identified. Four of the 5 patients carried diagnoses of JAK2V617F-positive MPNs (PMF and PV).

Though the above study found JAK2 translocations only in patients with JAK2V617F-positive MPNs, structural rearrangements, including JAK2translocations, have been found frequently in chromosomal analysis of samples from patients with JAK2V617F-negative MPNs [14]. The discovery of several of these translocations has shed light on theories of the pathogenesis and unique patterns of the disease. A prime example of this is the identification of t(8;9)(p22;p24), resulting in a PCM1-JAK2fusion gene product in a variety of hematologic diseases, including many in the spectrum of MPNs, such as atypical CML (aCML), CEL, myelodysplastic syndrome/MPN-unclassified (MDS/MPN-U), and myelofibrosis. Identifying the common translocation in cases of these disparate disorders has led to the recognition that patients with t(8;9)(p22;p24) are more likely to be male, have prominent erythroid dysplasia, and have high rates of peripheral blood and bone marrow eosinophilia [15]. PCM1-JAK2 was identified in both myeloid and lymphoid neoplasms, leading to the conclusion that malignancies with acquired t(8;9)(p22;p24) result from disorders of the pluripotent hematopoietic stem cell [16]. Increased recognition of the role of PCM1-JAK2 in hematologic malignancies has led to a relatively new categorization of “myeloid/lymphoid neoplasms with eosinophilia and rearrangement of PDGFRA, PDGFRB, or FGFR1, or with PCM1-JAK2” in the 2016 revision to the WHO classification of myeloid neoplasms and acute leukemia [17].

Similarly, both myeloid and lymphoid neoplasms with ETV6-JAK2 fusions have been identified. Animal modeling using this translocation has led to a proposed pathogenic mechanism involving the rearranged genes, which appears to cause constitutive activation of several STATs [18]. A number of cases have also been noted in which JAK2 fuses with the BCR gene on 9p24, resulting in aCML and unclassified MPNs [19, 20].

Here, we presented a case of a noveltranslocation t(1;9)(p36;p24.1) involving JAK2and peroxisomal biogenesis factor 14 (PEX14) found in a patient with JAK2V617F-negative PV, which transformed to an aggressive form of MPN-BP. PEX14 is a membrane protein involved in protein docking on peroxisomes, with a role in peroxisome formation and degradation. It also has a unique function as a transcriptional corepressor and a polypeptide transport modulator. Upregulation of PEX14 has been demonstrated in tissue from lung, rectal, ovarian, and esophageal carcinomas; however, its precise role in these malignancies remains unclear and information about its role in hematologic malignancies is absent [21]. Interestingly, like many other cases of JAK2V617F-negative, JAK2 translocation-positive MPNs, this patient’s disease was notable for prominent bone marrow eosinophilia of undetermined significance. JAK2 was identified as a fusion gene partner with a gene on chromosome 1 in only 1 other case of a hematologic malignancy – a TPM3-JAK2 fusion was found in a case of T-cell ALL [22].

Although commonalities between hematologic malignancies with JAK2 rearrangements have been identified, the prognostic significance and therapeutic implications of the translocations are not fully elucidated. As the disease of our patient progressed to MPN-BP, cytogenetic analysis showed a gain of 1q. We recently reported this to be associated with progression of MPNs to myelofibrosis and AML [23]. In vitro studies utilizing cell lines containing JAK2 rearrangements suggest a promising role for JAK inhibitors in halting malignant cell proliferation [22, 24]. Early case reports of ruxolitinib treatment in patients with MPNs containing JAK2 trans­locations also show positive outcomes in cytogenetic response and hematologic remission, although the durability of remission is variable and differences in outcomes are not well studied [25‒27]. As data accumulates about newly identified JAK2 translocations, further connections can be made between the specific translocations, disease course, and prognosis. Further information is needed to understand the translocations’ oncogenicity and the potential for novel targeted therapies aimed at targeting the specificJAK2 partners for this minority of MPN patients. In the future, MPNs may be stratified further into distinct entities that take into account specific JAK2 translocations.

The authors have no ethical disclosures to declare.

The authors have no conflicts of interest to declare.

H.L. and B.M. wrote the report. J.T. and D.G. performed cytogenetic and FISH studies. A.V.J. and N.C.P.C. performed molecular studies and analyses. J.M. was involved in clinical care and studies, and V.N. conceived and organized the work, and helped in preparing the report.

1.
Morgan
KJ
,
Gilliland
DG
.
A role for JAK2 mutations in myeloproliferative diseases
.
Annu Rev Med
.
2008
;
59
(
1
):
213
22
.
[PubMed]
0066-4219
2.
Smith
CA
,
Fan
G
.
The saga of JAK2 mutations and translocations in hematologic disorders: pathogenesis, diagnostic and therapeutic prospects, and revised World Health Organization diagnostic criteria for myeloproliferative neoplasms
.
Hum Pathol
.
2008
Jun
;
39
(
6
):
795
810
.
[PubMed]
0046-8177
3.
Patnaik
MM
,
Knudson
RA
,
Gangat
N
,
Hanson
CA
,
Pardanani
A
,
Tefferi
A
, et al
.
Chromosome 9p24 abnormalities: prevalence, description of novel JAK2 translocations, JAK2V617F mutation analysis and clinicopathologic correlates
.
Eur J Haematol
.
2010
Jun
;
84
(
6
):
518
24
.
[PubMed]
0902-4441
4.
Vizmanos
JL
,
Ormazábal
C
,
Larráyoz
MJ
,
Cross
NC
,
Calasanz
MJ
.
JAK2 V617F mutation in classic chronic myeloproliferative diseases: a report on a series of 349 patients
.
Leukemia
.
2006
Mar
;
20
(
3
):
534
5
.
[PubMed]
0887-6924
5.
Najfeld
V
,
Coyle
T
,
Berk
PD
.
Transformation of polycythemia vera to acute nonlymphocytic leukemia accompanied by t(1;3)(p36;q21) karyotype
.
Cancer Genet Cytogenet
.
1988
Jul
;
33
(
2
):
193
200
.
[PubMed]
0165-4608
6.
Najfeld
V
,
Montella
L
,
Scalise
A
,
Fruchtman
S
.
Exploring polycythaemia vera with fluorescence in situ hybridization: additional cryptic 9p is the most frequent abnormality detected
.
Br J Haematol
.
2002
Nov
;
119
(
2
):
558
66
.
[PubMed]
0007-1048
7.
Papaemmanuil
E
,
Rapado
I
,
Li
Y
,
Potter
NE
,
Wedge
DC
,
Tubio
J
, et al
.
RAG-mediated recombination is the predominant driver of oncogenic rearrangement in ETV6-RUNX1 acute lymphoblastic leukemia
.
Nat Genet
.
2014
Feb
;
46
(
2
):
116
25
.
[PubMed]
1061-4036
8.
Baxter
EJ
,
Scott
LM
,
Campbell
PJ
,
East
C
,
Fourouclas
N
,
Swanton
S
, et al;
Cancer Genome Project
.
Acquired mutation of the tyrosine kinase JAK2 in human myeloproliferative disorders
.
Lancet
.
2005
Mar
;
365
(
9464
):
1054
61
.
[PubMed]
0140-6736
9.
James
C
,
Ugo
V
,
Le Couédic
JP
,
Staerk
J
,
Delhommeau
F
,
Lacout
C
, et al
.
A unique clonal JAK2 mutation leading to constitutive signalling causes polycythaemia vera
.
Nature
.
2005
Apr
;
434
(
7037
):
1144
8
.
[PubMed]
0028-0836
10.
Kralovics
R
,
Passamonti
F
,
Buser
AS
,
Teo
SS
,
Tiedt
R
,
Passweg
JR
, et al
.
A gain-of-function mutation of JAK2 in myeloproliferative disorders
.
N Engl J Med
.
2005
Apr
;
352
(
17
):
1779
90
.
[PubMed]
0028-4793
11.
Levine
RL
,
Wadleigh
M
,
Cools
J
,
Ebert
BL
,
Wernig
G
,
Huntly
BJ
, et al
.
Activating mutation in the tyrosine kinase JAK2 in polycythemia vera, essential thrombocythemia, and myeloid metaplasia with myelofibrosis
.
Cancer Cell
.
2005
Apr
;
7
(
4
):
387
97
.
[PubMed]
1535-6108
12.
Yoshihara
K
,
Wang
Q
,
Torres-Garcia
W
,
Zheng
S
,
Vegesna
R
,
Kim
H
, et al
.
The landscape and therapeutic relevance of cancer-associated transcript fusions
.
Oncogene
.
2015
Sep
;
34
(
37
):
4845
54
.
[PubMed]
0950-9232
13.
Iwakawa
R
,
Takenaka
M
,
Kohno
T
,
Shimada
Y
,
Totoki
Y
,
Shibata
T
, et al
.
Genome-wide identification of genes with amplification and/or fusion in small cell lung cancer
.
Genes Chromosomes Cancer
.
2013
Sep
;
52
(
9
):
802
16
.
[PubMed]
1045-2257
14.
Najfeld
V
,
Cozza
A
,
Berkofsy-Fessler
W
,
Prchal
J
,
Scalise
A
.
Numerical gain and structural rearrangements of JAK2, identified by FISH, characterize both JAK2617V[{GT}]F-positive and -negative patients with Ph-negative MPD, myelodysplasia, and B-lymphoid neoplasms
.
Exp Hematol
.
2007
Nov
;
35
(
11
):
1668
76
.
[PubMed]
0301-472X
15.
Bain
BJ
,
Ahmad
S
.
Should myeloid and lymphoid neoplasms with PCM1-JAK2 and other rearrangements of JAK2 be recognized as specific entities
.
Br J Haematol
.
2014
Sep
;
166
(
6
):
809
17
.
[PubMed]
0007-1048
16.
Reiter
A
,
Walz
C
,
Watmore
A
,
Schoch
C
,
Blau
I
,
Schlegelberger
B
, et al
.
The t(8;9)(p22;p24) is a recurrent abnormality in chronic and acute leukemia that fuses PCM1 to JAK2
.
Cancer Res
.
2005
Apr
;
65
(
7
):
2662
7
.
[PubMed]
0008-5472
17.
Arber
DA
,
Orazi
A
,
Hasserjian
R
,
Thiele
J
,
Borowitz
MJ
,
Le Beau
MM
, et al
.
The 2016 revision to the World Health Organization classification of myeloid neoplasms and acute leukemia
.
Blood
.
2016
May
;
127
(
20
):
2391
405
.
[PubMed]
0006-4971
18.
Schwaller
J
.
Modeling ETV6-JAK2-induced leukemia: insights from the zebrafish
.
Haematologica
.
2012
Dec
;
97
(
12
):
1783
5
.
[PubMed]
0390-6078
19.
He
R
,
Greipp
PT
,
Rangan
A
,
Mai
M
,
Chen
D
,
Reichard
KK
, et al
.
BCR-JAK2 fusion in a myeloproliferative neoplasm with associated eosinophilia
.
Cancer Genet
.
2016
May
;
209
(
5
):
223
8
.
[PubMed]
2210-7762
20.
Impera
L
,
Lonoce
A
,
Fanfulla
DA
,
Moreilhon
C
,
Legros
L
,
Raynaud
S
, et al
.
Two alternatively spliced 5‘BCR/3’JAK2 fusion transcripts in a myeloproliferative neoplasm with a three-way t(9;18;22)(p23;p11.3;q11.2) translocation
.
Cancer Genet
.
2011
Sep
;
204
(
9
):
512
5
.
[PubMed]
2210-7762
21.
Yu
S
,
Wang
F
,
Zhang
K
,
Zhang
Y
,
Yang
K
,
Cheng
M
, et al
.
Immunocytochemical and immunohistochemical application of monoclonal antibodies against peroxisomal biogenesis factor 14
.
Hybridoma (Larchmt)
.
2012
Apr
;
31
(
2
):
142
5
.
[PubMed]
1554-0014
22.
Atak
ZK
,
Gianfelici
V
,
Hulselmans
G
,
De Keersmaecker
K
,
Devasia
AG
,
Geerdens
E
, et al
.
Comprehensive analysis of transcriptome variation uncovers known and novel driver events in T-cell acute lymphoblastic leukemia
.
PLoS Genet
.
2013
;
9
(
12
):
e1003997
.
[PubMed]
1553-7390
23.
Marcellino
BK
,
Hoffman
R
,
Tripodi
J
,
Lu
M
,
Kosiorek
H
,
Mascarenhas
J
, et al
.
Advanced forms of MPNs are accompanied by chromosomal abnormalities that lead to dysregulation of TP53
.
Blood Adv
.
2018
Dec
;
2
(
24
):
3581
9
.
[PubMed]
2473-9529
24.
Lierman
E
,
Selleslag
D
,
Smits
S
,
Billiet
J
,
Vandenberghe
P
.
Ruxolitinib inhibits transforming JAK2 fusion proteins in vitro and induces complete cytogenetic remission in t(8;9)(p22;p24)/PCM1-JAK2-positive chronic eosinophilic leukemia
.
Blood
.
2012
Aug
;
120
(
7
):
1529
31
.
[PubMed]
0006-4971
25.
Chase
A
,
Bryant
C
,
Score
J
,
Haferlach
C
,
Grossmann
V
,
Schwaab
J
, et al
.
Ruxolitinib as potential targeted therapy for patients with JAK2 rearrangements
.
Haematologica
.
2013
Mar
;
98
(
3
):
404
8
.
[PubMed]
0390-6078
26.
Rumi
E
,
Milosevic
JD
,
Selleslag
D
,
Casetti
I
,
Lierman
E
,
Pietra
D
, et al
.
Efficacy of ruxolitinib in myeloid neoplasms with PCM1-JAK2 fusion gene
.
Ann Hematol
.
2015
Nov
;
94
(
11
):
1927
8
.
[PubMed]
0939-5555
27.
Schwaab
J
,
Knut
M
,
Haferlach
C
,
Metzgeroth
G
,
Horny
HP
,
Chase
A
, et al
.
Limited duration of complete remission on ruxolitinib in myeloid neoplasms with PCM1-JAK2 and BCR-JAK2 fusion genes
.
Ann Hematol
.
2015
Feb
;
94
(
2
):
233
8
.
[PubMed]
0939-5555
28.
Lacronique
V
,
Boureux
A
,
Valle
VD
,
Poirel
H
,
Quang
CT
,
Mauchauffé
M
, et al
.
A TEL-JAK2 fusion protein with constitutive kinase activity in human leukemia
.
Science
.
1997
Nov
;
278
(
5341
):
1309
12
.
[PubMed]
0036-8075
29.
Peeters
P
,
Raynaud
SD
,
Cools
J
,
Wlodarska
I
,
Grosgeorge
J
,
Philip
P
, et al
.
Fusion of TEL, the ETS-variant gene 6 (ETV6), to the receptor-associated kinase JAK2 as a result of t(9;12) in a lymphoid and t(9;15;12) in a myeloid leukemia
.
Blood
.
1997
Oct
;
90
(
7
):
2535
40
.
[PubMed]
0006-4971
30.
Zhou
MH
,
Gao
L
,
Jing
Y
,
Xu
YY
,
Ding
Y
,
Wang
N
, et al
.
Detection of ETV6 gene rearrangements in adult acute lymphoblastic leukemia
.
Ann Hematol
.
2012
Aug
;
91
(
8
):
1235
43
.
[PubMed]
0939-5555
31.
Griesinger
F
,
Hennig
H
,
Hillmer
F
,
Podleschny
M
,
Steffens
R
,
Pies
A
, et al
.
A BCR-JAK2 fusion gene as the result of a t(9;22)(p24;q11.2) translocation in a patient with a clinically typical chronic myeloid leukemia
.
Genes Chromosomes Cancer
.
2005
Nov
;
44
(
3
):
329
33
.
[PubMed]
1045-2257
32.
Xu
Y
,
Yin
J
,
Pan
J
,
Wu
C
,
Wang
Q
,
Yao
H
, et al
.
A BCR-JAK2 fusion gene from ins(22;9)(q11;p13p24) in a patient with atypical chronic myeloid leukemia
.
Leuk Lymphoma
.
2013
Oct
;
54
(
10
):
2322
4
.
[PubMed]
1042-8194
33.
Elnaggar
MM
,
Agersborg
S
,
Sahoo
T
,
Girgin
A
,
Ma
W
,
Rakkhit
R
, et al
.
BCR-JAK2 fusion as a result of a translocation (9;22)(p24;q11.2) in a patient with CML-like myeloproliferative disease
.
Mol Cytogenet
.
2012
May
;
5
(
1
):
23
.
[PubMed]
1755-8166
34.
Kantarcioglu
B
,
Kaygusuz-Atagunduz
I
,
Uzay
A
,
Toptas
T
,
Tuglular
TF
,
Bayik
M
.
Myelodysplastic syndrome with t(9;22)(p24;q11.2), a BCR-JAK2 fusion: case report and review of the literature
.
Int J Hematol
.
2015
Sep
;
102
(
3
):
383
7
.
[PubMed]
0925-5710
35.
Saba
N
,
Safah
H
.
A myeloproliferative neoplasm with translocation t(8;9)(p22;p24) involving JAK2 gene
.
Blood
.
2013
Aug
;
122
(
6
):
861
.
[PubMed]
0006-4971
36.
Bousquet
M
,
Quelen
C
,
De Mas
V
,
Duchayne
E
,
Roquefeuil
B
,
Delsol
G
, et al
.
The t(8;9)(p22;p24) translocation in atypical chronic myeloid leukaemia yields a new PCM1-JAK2 fusion gene
.
Oncogene
.
2005
Nov
;
24
(
48
):
7248
52
.
[PubMed]
0950-9232
37.
Murati
A
,
Gelsi-Boyer
V
,
Adélaïde
J
,
Perot
C
,
Talmant
P
,
Giraudier
S
, et al
.
PCM1-JAK2 fusion in myeloproliferative disorders and acute erythroid leukemia with t(8;9) translocation
.
Leukemia
.
2005
Sep
;
19
(
9
):
1692
6
.
[PubMed]
0887-6924
38.
Mark
HF
,
Sotomayor
EA
,
Nelson
M
,
Chaves
F
,
Sanger
WG
,
Kaleem
Z
, et al
.
Chronic idiopathic myelofibrosis (CIMF) resulting from a unique 3;9 translocation disrupting the janus kinase 2 (JAK2) gene
.
Exp Mol Pathol
.
2006
Dec
;
81
(
3
):
217
23
.
[PubMed]
0014-4800
39.
Adélaïde
J
,
Pérot
C
,
Gelsi-Boyer
V
,
Pautas
C
,
Murati
A
,
Copie-Bergman
C
, et al
.
A t(8;9) translocation with PCM1-JAK2 fusion in a patient with T-cell lymphoma
.
Leukemia
.
2006
Mar
;
20
(
3
):
536
7
.
[PubMed]
0887-6924
40.
Andersson
AK
,
Ma
J
,
Wang
J
,
Chen
X
,
Gedman
AL
,
Dang
J
, et al;
St. Jude Children’s Research Hospital–Washington University Pediatric Cancer Genome Project
.
The landscape of somatic mutations in infant MLL-rearranged acute lymphoblastic leukemias
.
Nat Genet
.
2015
Apr
;
47
(
4
):
330
7
.
[PubMed]
1061-4036
41.
Kawamura
M
,
Taki
T
,
Kaku
H
,
Ohki
K
,
Hayashi
Y
.
Identification of SPAG9 as a novel JAK2 fusion partner gene in pediatric acute lymphoblastic leukemia with t(9;17)(p24;q21)
.
Genes Chromosomes Cancer
.
2015
Jul
;
54
(
7
):
401
8
.
[PubMed]
1045-2257
42.
Roberts
KG
,
Morin
RD
,
Zhang
J
,
Hirst
M
,
Zhao
Y
,
Su
X
, et al
.
Genetic alterations activating kinase and cytokine receptor signaling in high-risk acute lymphoblastic leukemia
.
Cancer Cell
.
2012
Aug
;
22
(
2
):
153
66
.
[PubMed]
1535-6108
43.
Yano
M
,
Imamura
T
,
Asai
D
,
Kiyokawa
N
,
Nakabayashi
K
,
Matsumoto
K
, et al
.
Identification of novel kinase fusion transcripts in paediatric B cell precursor acute lymphoblastic leukaemia with IKZF1 deletion
.
Br J Haematol
.
2015
Dec
;
171
(
5
):
813
7
.
[PubMed]
0007-1048
44.
Poitras
JL
,
Dal Cin
P
,
Aster
JC
,
Deangelo
DJ
,
Morton
CC
.
Novel SSBP2-JAK2 fusion gene resulting from a t(5;9)(q14.1;p24.1) in pre-B acute lymphocytic leukemia
.
Genes Chromosomes Cancer
.
2008
Oct
;
47
(
10
):
884
9
.
[PubMed]
1045-2257
45.
Nebral
K
,
Denk
D
,
Attarbaschi
A
,
König
M
,
Mann
G
,
Haas
OA
, et al
.
Incidence and diversity of PAX5 fusion genes in childhood acute lymphoblastic leukemia
.
Leukemia
.
2009
Jan
;
23
(
1
):
134
43
.
[PubMed]
0887-6924
46.
Van Roosbroeck
K
,
Cox
L
,
Tousseyn
T
,
Lahortiga
I
,
Gielen
O
,
Cauwelier
B
, et al
.
JAK2 rearrangements, including the novel SEC31A-JAK2 fusion, are recurrent in classical Hodgkin lymphoma
.
Blood
.
2011
Apr
;
117
(
15
):
4056
64
.
[PubMed]
0006-4971